\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614958335:

Variant ID: vg0614958335 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14958335
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTCCAATAATTCTTAGTATAGATATTGCCATGATTATCAAAGTGTAGAACCATGTAAATTGCTTCATCATTGAATAAGATTTTAGCTAAAGATCTGGT[C/T,G]
CTGCTAGTATGTCACTATCTTCAGAAGATTCAGTTAATTCAACATGTATGCATATATAAGGACCAATGATGTTAGTGTGATTTAAATTTCAGTAATTCAA

Reverse complement sequence

TTGAATTACTGAAATTTAAATCACACTAACATCATTGGTCCTTATATATGCATACATGTTGAATTAACTGAATCTTCTGAAGATAGTGACATACTAGCAG[G/A,C]
ACCAGATCTTTAGCTAAAATCTTATTCAATGATGAAGCAATTTACATGGTTCTACACTTTGATAATCATGGCAATATCTATACTAAGAATTATTGGACTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.00% 5.90% 3.34% 14.77% NA
All Indica  2759 70.10% 9.50% 5.11% 15.33% NA
All Japonica  1512 86.50% 0.10% 0.53% 12.83% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 76.60% 7.60% 13.78% 2.02% NA
Indica II  465 82.60% 1.90% 4.09% 11.40% NA
Indica III  913 64.80% 8.20% 0.77% 26.18% NA
Indica Intermediate  786 63.70% 16.90% 4.20% 15.14% NA
Temperate Japonica  767 98.00% 0.30% 0.13% 1.56% NA
Tropical Japonica  504 65.10% 0.00% 0.79% 34.13% NA
Japonica Intermediate  241 94.60% 0.00% 1.24% 4.15% NA
VI/Aromatic  96 22.90% 11.50% 3.12% 62.50% NA
Intermediate  90 68.90% 3.30% 5.56% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614958335 C -> G LOC_Os06g25580.1 downstream_gene_variant ; 1610.0bp to feature; MODIFIER N Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0614958335 C -> G LOC_Os06g25570-LOC_Os06g25580 intergenic_region ; MODIFIER N Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0614958335 C -> T LOC_Os06g25580.1 downstream_gene_variant ; 1610.0bp to feature; MODIFIER silent_mutation Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0614958335 C -> T LOC_Os06g25570-LOC_Os06g25580 intergenic_region ; MODIFIER silent_mutation Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0614958335 C -> DEL N N silent_mutation Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614958335 NA 3.38E-07 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 1.57E-07 mr1032 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 1.04E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 7.03E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 1.53E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 8.73E-06 NA mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 8.51E-08 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 1.92E-08 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 1.95E-07 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 3.75E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 2.02E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614958335 NA 8.99E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251