\
| Variant ID: vg0614958335 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14958335 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAGTCCAATAATTCTTAGTATAGATATTGCCATGATTATCAAAGTGTAGAACCATGTAAATTGCTTCATCATTGAATAAGATTTTAGCTAAAGATCTGGT[C/T,G]
CTGCTAGTATGTCACTATCTTCAGAAGATTCAGTTAATTCAACATGTATGCATATATAAGGACCAATGATGTTAGTGTGATTTAAATTTCAGTAATTCAA
TTGAATTACTGAAATTTAAATCACACTAACATCATTGGTCCTTATATATGCATACATGTTGAATTAACTGAATCTTCTGAAGATAGTGACATACTAGCAG[G/A,C]
ACCAGATCTTTAGCTAAAATCTTATTCAATGATGAAGCAATTTACATGGTTCTACACTTTGATAATCATGGCAATATCTATACTAAGAATTATTGGACTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.00% | 5.90% | 3.34% | 14.77% | NA |
| All Indica | 2759 | 70.10% | 9.50% | 5.11% | 15.33% | NA |
| All Japonica | 1512 | 86.50% | 0.10% | 0.53% | 12.83% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.37% | 0.37% | NA |
| Indica I | 595 | 76.60% | 7.60% | 13.78% | 2.02% | NA |
| Indica II | 465 | 82.60% | 1.90% | 4.09% | 11.40% | NA |
| Indica III | 913 | 64.80% | 8.20% | 0.77% | 26.18% | NA |
| Indica Intermediate | 786 | 63.70% | 16.90% | 4.20% | 15.14% | NA |
| Temperate Japonica | 767 | 98.00% | 0.30% | 0.13% | 1.56% | NA |
| Tropical Japonica | 504 | 65.10% | 0.00% | 0.79% | 34.13% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.00% | 1.24% | 4.15% | NA |
| VI/Aromatic | 96 | 22.90% | 11.50% | 3.12% | 62.50% | NA |
| Intermediate | 90 | 68.90% | 3.30% | 5.56% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614958335 | C -> G | LOC_Os06g25580.1 | downstream_gene_variant ; 1610.0bp to feature; MODIFIER | N | Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0614958335 | C -> G | LOC_Os06g25570-LOC_Os06g25580 | intergenic_region ; MODIFIER | N | Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0614958335 | C -> T | LOC_Os06g25580.1 | downstream_gene_variant ; 1610.0bp to feature; MODIFIER | silent_mutation | Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0614958335 | C -> T | LOC_Os06g25570-LOC_Os06g25580 | intergenic_region ; MODIFIER | silent_mutation | Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0614958335 | C -> DEL | N | N | silent_mutation | Average:33.034; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614958335 | NA | 3.38E-07 | mr1020 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 1.57E-07 | mr1032 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 1.04E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 7.03E-07 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 1.53E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | 8.73E-06 | NA | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 8.51E-08 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 1.92E-08 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 1.95E-07 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 3.75E-06 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 2.02E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614958335 | NA | 8.99E-06 | mr1977_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |