Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614945451:

Variant ID: vg0614945451 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14945451
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTATTAAAAATACCCACAAGCCAATTTGACATAAATCTTGGTGAATTTTAATTGTTGGAGGCTCTTTTAGGCTTTTAAAATTTCTAGAAATGCATTAA[A/G]
GCACGATTTAAATTTAGGGCGATTTTCAGGGCGTTACAGTACATAGCAAAAGATGACAAAATATCGACAAATCCCTACTTATGGCACTGTTTGATAGGTG

Reverse complement sequence

CACCTATCAAACAGTGCCATAAGTAGGGATTTGTCGATATTTTGTCATCTTTTGCTATGTACTGTAACGCCCTGAAAATCGCCCTAAATTTAAATCGTGC[T/C]
TTAATGCATTTCTAGAAATTTTAAAAGCCTAAAAGAGCCTCCAACAATTAAAATTCACCAAGATTTATGTCAAATTGGCTTGTGGGTATTTTTAATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.90%	37.70%	0.38%	0.00%	NA
All Indica	2759	96.10%	3.30%	0.62%	0.00%	NA
All Japonica	1512	9.00%	91.00%	0.00%	0.00%	NA
Aus	269	29.70%	70.30%	0.00%	0.00%	NA
Indica I	595	94.10%	4.00%	1.85%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	97.90%	1.60%	0.44%	0.00%	NA
Indica Intermediate	786	94.00%	5.70%	0.25%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	17.70%	82.30%	0.00%	0.00%	NA
Japonica Intermediate	241	7.50%	92.50%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614945451	A -> G	LOC_Os06g25560.1	upstream_gene_variant ; 1836.0bp to feature; MODIFIER	silent_mutation	Average:56.622; most accessible tissue: Callus, score: 89.752	N	N	N	N
vg0614945451	A -> G	LOC_Os06g25570.1	upstream_gene_variant ; 942.0bp to feature; MODIFIER	silent_mutation	Average:56.622; most accessible tissue: Callus, score: 89.752	N	N	N	N
vg0614945451	A -> G	LOC_Os06g25550.1	downstream_gene_variant ; 3851.0bp to feature; MODIFIER	silent_mutation	Average:56.622; most accessible tissue: Callus, score: 89.752	N	N	N	N
vg0614945451	A -> G	LOC_Os06g25560-LOC_Os06g25570	intergenic_region ; MODIFIER	silent_mutation	Average:56.622; most accessible tissue: Callus, score: 89.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614945451	1.98E-08	1.54E-10	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	6.93E-11	6.93E-11	mr1032	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	NA	4.94E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	NA	2.25E-52	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	1.39E-06	1.39E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	NA	9.10E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	NA	2.75E-50	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	NA	8.53E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	1.70E-08	1.70E-08	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	NA	1.07E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	8.98E-07	3.36E-10	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	NA	5.44E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	4.52E-06	7.28E-09	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614945451	NA	5.37E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251