\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614933791:

Variant ID: vg0614933791 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14933791
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCGTCCCAATAAACTGAAAAGGCCCACATGTCATCCAAATAAAGGAAGCTTCCTGCAGTACTCAAACAGTTAATACATTGCCCCACGATGACCACTAA[C/T]
CATGCATGCACTCAGCAAATAACTGAAAGGGCCCACATGTCATCCAAATAAAGGAAGCTTCCTGTAGTAATCAGTTAGTTAACCCATTGTCTCACGATTA

Reverse complement sequence

TAATCGTGAGACAATGGGTTAACTAACTGATTACTACAGGAAGCTTCCTTTATTTGGATGACATGTGGGCCCTTTCAGTTATTTGCTGAGTGCATGCATG[G/A]
TTAGTGGTCATCGTGGGGCAATGTATTAACTGTTTGAGTACTGCAGGAAGCTTCCTTTATTTGGATGACATGTGGGCCTTTTCAGTTTATTGGGACGAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 37.90% 0.17% 0.00% NA
All Indica  2759 96.20% 3.50% 0.29% 0.00% NA
All Japonica  1512 9.00% 91.00% 0.00% 0.00% NA
Aus  269 29.70% 70.30% 0.00% 0.00% NA
Indica I  595 94.80% 4.40% 0.84% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 93.80% 6.00% 0.25% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 17.70% 82.30% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614933791 C -> T LOC_Os06g25540.1 upstream_gene_variant ; 190.0bp to feature; MODIFIER silent_mutation Average:78.643; most accessible tissue: Zhenshan97 flower, score: 91.609 N N N N
vg0614933791 C -> T LOC_Os06g25550.1 upstream_gene_variant ; 3601.0bp to feature; MODIFIER silent_mutation Average:78.643; most accessible tissue: Zhenshan97 flower, score: 91.609 N N N N
vg0614933791 C -> T LOC_Os06g25530.1 downstream_gene_variant ; 1485.0bp to feature; MODIFIER silent_mutation Average:78.643; most accessible tissue: Zhenshan97 flower, score: 91.609 N N N N
vg0614933791 C -> T LOC_Os06g25530-LOC_Os06g25540 intergenic_region ; MODIFIER silent_mutation Average:78.643; most accessible tissue: Zhenshan97 flower, score: 91.609 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0614933791 C T 0.03 0.02 0.01 -0.03 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614933791 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 3.22E-07 3.22E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 1.88E-06 1.19E-06 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 9.24E-06 1.82E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 6.55E-07 1.04E-06 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 NA 4.50E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 1.17E-07 1.17E-07 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 6.39E-06 5.22E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 NA 4.50E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 NA 1.28E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 NA 6.20E-16 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614933791 NA 4.94E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251