\
| Variant ID: vg0614844474 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14844474 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 119. )
GATCGATTTCGCGTGTGTTGCGTGAAGGCGACGGCTCGGTTTATATAGAGATAGGTCGCCTGATCAGGGCGCCAGCGTAACCGAACCGGATAAGTCGCGC[G/A]
TAACCTATCCAGACTCCACGCCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAAAACAAAACAAATCCGAATTTCCCGCAGTAAAACAAAACCGCAA
TTGCGGTTTTGTTTTACTGCGGGAAATTCGGATTTGTTTTGTTTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGCGTGGAGTCTGGATAGGTTA[C/T]
GCGCGACTTATCCGGTTCGGTTACGCTGGCGCCCTGATCAGGCGACCTATCTCTATATAAACCGAGCCGTCGCCTTCACGCAACACACGCGAAATCGATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.60% | 37.90% | 0.44% | 0.06% | NA |
| All Indica | 2759 | 95.90% | 3.30% | 0.65% | 0.11% | NA |
| All Japonica | 1512 | 8.70% | 91.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 4.50% | 1.01% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.40% | 0.80% | 0.66% | 0.22% | NA |
| Indica Intermediate | 786 | 93.10% | 6.10% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 3.50% | 96.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 17.10% | 82.50% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614844474 | G -> A | LOC_Os06g25340.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.508; most accessible tissue: Minghui63 flag leaf, score: 81.566 | N | N | N | N |
| vg0614844474 | G -> DEL | N | N | silent_mutation | Average:61.508; most accessible tissue: Minghui63 flag leaf, score: 81.566 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614844474 | NA | 2.80E-06 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | 3.22E-07 | 3.22E-07 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 4.15E-12 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 2.22E-56 | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 3.56E-50 | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 3.94E-46 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 4.30E-43 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | 7.99E-06 | 5.97E-08 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 1.37E-26 | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 1.91E-50 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | 1.64E-06 | 3.48E-07 | mr1227 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 2.04E-11 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 2.92E-14 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 1.07E-27 | mr1426 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | 1.17E-07 | 1.17E-07 | mr1478 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | 5.45E-06 | NA | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | 4.79E-07 | 4.79E-07 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 3.06E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 1.28E-07 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | 3.01E-07 | 6.20E-16 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 1.00E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 4.94E-09 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614844474 | NA | 3.61E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |