\
| Variant ID: vg0614842115 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14842115 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAACATCATGTCAACCATGCGCCGTGATACTTAACAAGTACCCGAATAGAGATTGTGACAATGCCCTCTATATAATACAATTCAAAGTAGTGCACCATTC[C/T]
CGGATCATAATCACCCCCTTATAAACAAGGTATGGACTCCCCAGCGACCCCCGTGGGCTTATCTCCGCCACTTCACAGTCTGGTACTCTACAATGAACCA
TGGTTCATTGTAGAGTACCAGACTGTGAAGTGGCGGAGATAAGCCCACGGGGGTCGCTGGGGAGTCCATACCTTGTTTATAAGGGGGTGATTATGATCCG[G/A]
GAATGGTGCACTACTTTGAATTGTATTATATAGAGGGCATTGTCACAATCTCTATTCGGGTACTTGTTAAGTATCACGGCGCATGGTTGACATGATGTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 0.10% | 8.68% | 34.83% | NA |
| All Indica | 2759 | 32.20% | 0.10% | 13.59% | 54.11% | NA |
| All Japonica | 1512 | 94.20% | 0.10% | 0.86% | 4.83% | NA |
| Aus | 269 | 76.60% | 0.00% | 5.20% | 18.22% | NA |
| Indica I | 595 | 38.00% | 0.00% | 5.71% | 56.30% | NA |
| Indica II | 465 | 34.80% | 0.20% | 14.62% | 50.32% | NA |
| Indica III | 913 | 20.30% | 0.00% | 18.84% | 60.90% | NA |
| Indica Intermediate | 786 | 40.10% | 0.30% | 12.85% | 46.82% | NA |
| Temperate Japonica | 767 | 96.90% | 0.00% | 0.91% | 2.22% | NA |
| Tropical Japonica | 504 | 89.30% | 0.00% | 0.60% | 10.12% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.40% | 1.24% | 2.07% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 66.70% | 0.00% | 8.89% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614842115 | C -> T | LOC_Os06g25330.1 | downstream_gene_variant ; 3829.0bp to feature; MODIFIER | silent_mutation | Average:18.684; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0614842115 | C -> T | LOC_Os06g25340.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.684; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0614842115 | C -> DEL | N | N | silent_mutation | Average:18.684; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614842115 | NA | 3.81E-06 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 4.25E-06 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 2.33E-08 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | 2.07E-06 | 9.28E-10 | mr1119 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | 5.46E-06 | 4.38E-08 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 4.20E-11 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 9.86E-06 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 7.73E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 6.68E-06 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 3.70E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 3.92E-11 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 4.67E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 3.08E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 4.74E-07 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614842115 | NA | 5.23E-06 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |