\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614842115:

Variant ID: vg0614842115 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14842115
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACATCATGTCAACCATGCGCCGTGATACTTAACAAGTACCCGAATAGAGATTGTGACAATGCCCTCTATATAATACAATTCAAAGTAGTGCACCATTC[C/T]
CGGATCATAATCACCCCCTTATAAACAAGGTATGGACTCCCCAGCGACCCCCGTGGGCTTATCTCCGCCACTTCACAGTCTGGTACTCTACAATGAACCA

Reverse complement sequence

TGGTTCATTGTAGAGTACCAGACTGTGAAGTGGCGGAGATAAGCCCACGGGGGTCGCTGGGGAGTCCATACCTTGTTTATAAGGGGGTGATTATGATCCG[G/A]
GAATGGTGCACTACTTTGAATTGTATTATATAGAGGGCATTGTCACAATCTCTATTCGGGTACTTGTTAAGTATCACGGCGCATGGTTGACATGATGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 0.10% 8.68% 34.83% NA
All Indica  2759 32.20% 0.10% 13.59% 54.11% NA
All Japonica  1512 94.20% 0.10% 0.86% 4.83% NA
Aus  269 76.60% 0.00% 5.20% 18.22% NA
Indica I  595 38.00% 0.00% 5.71% 56.30% NA
Indica II  465 34.80% 0.20% 14.62% 50.32% NA
Indica III  913 20.30% 0.00% 18.84% 60.90% NA
Indica Intermediate  786 40.10% 0.30% 12.85% 46.82% NA
Temperate Japonica  767 96.90% 0.00% 0.91% 2.22% NA
Tropical Japonica  504 89.30% 0.00% 0.60% 10.12% NA
Japonica Intermediate  241 96.30% 0.40% 1.24% 2.07% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 66.70% 0.00% 8.89% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614842115 C -> T LOC_Os06g25330.1 downstream_gene_variant ; 3829.0bp to feature; MODIFIER silent_mutation Average:18.684; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0614842115 C -> T LOC_Os06g25340.1 intron_variant ; MODIFIER silent_mutation Average:18.684; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0614842115 C -> DEL N N silent_mutation Average:18.684; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614842115 NA 3.81E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 4.25E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 2.33E-08 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 2.07E-06 9.28E-10 mr1119 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 5.46E-06 4.38E-08 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 4.20E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 9.86E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 7.73E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 6.68E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 3.70E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 3.92E-11 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 4.67E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 3.08E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 4.74E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614842115 NA 5.23E-06 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251