Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614799711:

Variant ID: vg0614799711 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14799711
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

AATAATCTAAGCTAGGTGGAAAGAAAAGAGAAAGAGAATCTATTCCTATACTTTCTAGTTAACTGACATACTAGCTAATACCCTCTATCCGATGCCCTCC[T/C]
GGTACATCGAGAAGCCACCCCTGACTGCCGAGTTCCTTACGACAGCCCGTCGTGACCATACAACCCTGGAAATTAACTTAGGATTATATATAGGCACGGA

Reverse complement sequence

TCCGTGCCTATATATAATCCTAAGTTAATTTCCAGGGTTGTATGGTCACGACGGGCTGTCGTAAGGAACTCGGCAGTCAGGGGTGGCTTCTCGATGTACC[A/G]
GGAGGGCATCGGATAGAGGGTATTAGCTAGTATGTCAGTTAACTAGAAAGTATAGGAATAGATTCTCTTTCTCTTTTCTTTCCACCTAGCTTAGATTATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.10%	30.70%	0.17%	0.00%	NA
All Indica	2759	50.00%	49.80%	0.25%	0.00%	NA
All Japonica	1512	98.80%	1.20%	0.00%	0.00%	NA
Aus	269	89.60%	10.40%	0.00%	0.00%	NA
Indica I	595	18.50%	81.50%	0.00%	0.00%	NA
Indica II	465	26.90%	72.70%	0.43%	0.00%	NA
Indica III	913	85.30%	14.50%	0.22%	0.00%	NA
Indica Intermediate	786	46.40%	53.20%	0.38%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614799711	T -> C	LOC_Os06g25280.1	upstream_gene_variant ; 677.0bp to feature; MODIFIER	silent_mutation	Average:44.409; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0614799711	T -> C	LOC_Os06g25280-LOC_Os06g25290	intergenic_region ; MODIFIER	silent_mutation	Average:44.409; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614799711	NA	3.69E-11	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.29E-09	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.32E-09	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	8.30E-42	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	8.95E-11	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	6.61E-10	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	2.48E-14	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	4.02E-06	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.28E-45	mr1234	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.83E-09	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	2.78E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.55E-08	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	3.66E-17	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	2.07E-28	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	2.45E-07	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.48E-12	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	4.79E-11	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	4.82E-08	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	3.35E-13	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	4.66E-50	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.30E-11	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	6.47E-54	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.82E-12	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	7.79E-09	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.84E-21	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.37E-35	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	9.51E-58	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.80E-12	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	4.50E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	4.55E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.41E-08	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	9.89E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	2.18E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	3.72E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.63E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.22E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	1.78E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	3.46E-12	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	1.94E-06	1.36E-30	mr1877_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614799711	NA	2.77E-10	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251