\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614739287:

Variant ID: vg0614739287 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14739287
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGCCTCCACCTTGACTTGGACGTCCTCGATGATCCTCCATGGCTCTAAGTCCTTCTCCAAGTGTCTCCTTGTCCCCTCCATTGTTCCTAATCACAATA[C/T]
AATTATTAGGTAGCAATCTATTCTCGAATTCATACAAAGAAGAACATAGGAACGAGCTCACCTCTAAATTTAATTGTCGCGCACGAGCTCTTGTTATTGG

Reverse complement sequence

CCAATAACAAGAGCTCGTGCGCGACAATTAAATTTAGAGGTGAGCTCGTTCCTATGTTCTTCTTTGTATGAATTCGAGAATAGATTGCTACCTAATAATT[G/A]
TATTGTGATTAGGAACAATGGAGGGGACAAGGAGACACTTGGAGAAGGACTTAGAGCCATGGAGGATCATCGAGGACGTCCAAGTCAAGGTGGAGGCCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 32.80% 0.93% 27.74% NA
All Indica  2759 48.90% 4.80% 1.52% 44.73% NA
All Japonica  1512 8.10% 90.90% 0.00% 0.99% NA
Aus  269 85.10% 1.90% 0.00% 13.01% NA
Indica I  595 16.50% 9.10% 2.18% 72.27% NA
Indica II  465 28.60% 3.40% 2.15% 65.81% NA
Indica III  913 84.90% 0.80% 0.44% 13.91% NA
Indica Intermediate  786 43.80% 7.10% 1.91% 47.20% NA
Temperate Japonica  767 2.30% 96.50% 0.00% 1.17% NA
Tropical Japonica  504 17.30% 82.10% 0.00% 0.60% NA
Japonica Intermediate  241 7.10% 91.70% 0.00% 1.24% NA
VI/Aromatic  96 88.50% 1.00% 0.00% 10.42% NA
Intermediate  90 38.90% 40.00% 2.22% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614739287 C -> T LOC_Os06g25180.1 upstream_gene_variant ; 2162.0bp to feature; MODIFIER silent_mutation Average:26.513; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0614739287 C -> T LOC_Os06g25190.1 upstream_gene_variant ; 18.0bp to feature; MODIFIER silent_mutation Average:26.513; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0614739287 C -> T LOC_Os06g25200.1 upstream_gene_variant ; 841.0bp to feature; MODIFIER silent_mutation Average:26.513; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0614739287 C -> T LOC_Os06g25190-LOC_Os06g25200 intergenic_region ; MODIFIER silent_mutation Average:26.513; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0614739287 C -> DEL N N silent_mutation Average:26.513; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614739287 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 3.22E-07 3.22E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 NA 4.15E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 7.99E-06 5.97E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 1.17E-07 1.17E-07 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 4.79E-07 4.79E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 NA 1.28E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 NA 6.20E-16 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 NA 1.35E-07 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 NA 5.53E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 NA 1.84E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 NA 4.27E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 NA 4.94E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 1.22E-06 7.03E-11 mr1583_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614739287 NA 1.98E-10 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251