Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614719643:

Variant ID: vg0614719643 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14719643
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGAATTATTATGAACTTAATATTGAAACTTAAAATTTCTTTTGTTAATTGAAGCATCAACTCCTTTACAAAAGAATTGCGAAACAAAACTTGCTTTAT[A/G]
CTGAAATTGAACTACATATTGCCTTCCTTTGAATATATGCCTTACATGTAGTATGGTAGGATTGACTTGTGCTTGCCAGTACATTAACTTGTTTAATGTA

Reverse complement sequence

TACATTAAACAAGTTAATGTACTGGCAAGCACAAGTCAATCCTACCATACTACATGTAAGGCATATATTCAAAGGAAGGCAATATGTAGTTCAATTTCAG[T/C]
ATAAAGCAAGTTTTGTTTCGCAATTCTTTTGTAAAGGAGTTGATGCTTCAATTAACAAAAGAAATTTTAAGTTTCAATATTAAGTTCATAATAATTCCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.50%	33.90%	1.35%	27.19%	NA
All Indica	2759	48.00%	6.60%	1.45%	43.93%	NA
All Japonica	1512	8.00%	91.10%	0.07%	0.86%	NA
Aus	269	85.50%	2.20%	0.37%	11.90%	NA
Indica I	595	13.90%	14.10%	3.36%	68.57%	NA
Indica II	465	28.20%	5.40%	1.72%	64.73%	NA
Indica III	913	84.70%	0.80%	0.33%	14.24%	NA
Indica Intermediate	786	43.00%	8.40%	1.15%	47.46%	NA
Temperate Japonica	767	2.20%	96.60%	0.00%	1.17%	NA
Tropical Japonica	504	17.30%	82.30%	0.00%	0.40%	NA
Japonica Intermediate	241	7.10%	91.70%	0.41%	0.83%	NA
VI/Aromatic	96	67.70%	1.00%	20.83%	10.42%	NA
Intermediate	90	36.70%	41.10%	2.22%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614719643	A -> G	LOC_Os06g25150.1	upstream_gene_variant ; 3556.0bp to feature; MODIFIER	silent_mutation	Average:22.776; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg0614719643	A -> G	LOC_Os06g25160.1	downstream_gene_variant ; 848.0bp to feature; MODIFIER	silent_mutation	Average:22.776; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg0614719643	A -> G	LOC_Os06g25150-LOC_Os06g25160	intergenic_region ; MODIFIER	silent_mutation	Average:22.776; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg0614719643	A -> DEL	N	N	silent_mutation	Average:22.776; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614719643	NA	2.80E-06	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	3.22E-07	3.22E-07	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	NA	4.15E-12	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	7.99E-06	5.97E-08	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	1.17E-07	1.17E-07	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	4.79E-07	4.79E-07	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	NA	1.28E-07	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	NA	6.20E-16	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	NA	9.46E-06	mr1364_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	NA	4.94E-09	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614719643	9.28E-06	8.38E-08	mr1734_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251