| Variant ID: vg0614714911 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14714911 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAATATTAGACTAGAAATGTCATCAAGCATTTGAGCATACATGTGCATAATGCATGCCTAGGCTTGAGTCCATTGTGCATTTGGATTTTGGTCTCGCTTT[A/T]
AATAATAGGTCTCATGAGCATAAACTAAAAGGGTTAAAATTACTAAGCAAAACTATAGTTAATATTAAATTCTAATATATTTTTCTCAGCCCAAAAGAAG
CTTCTTTTGGGCTGAGAAAAATATATTAGAATTTAATATTAACTATAGTTTTGCTTAGTAATTTTAACCCTTTTAGTTTATGCTCATGAGACCTATTATT[T/A]
AAAGCGAGACCAAAATCCAAATGCACAATGGACTCAAGCCTAGGCATGCATTATGCACATGTATGCTCAAATGCTTGATGACATTTCTAGTCTAATATTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.30% | 33.00% | 1.38% | 28.31% | NA |
| All Indica | 2759 | 47.70% | 5.20% | 2.21% | 44.91% | NA |
| All Japonica | 1512 | 8.10% | 90.70% | 0.00% | 1.19% | NA |
| Aus | 269 | 85.50% | 1.90% | 0.74% | 11.90% | NA |
| Indica I | 595 | 13.10% | 10.40% | 3.03% | 73.45% | NA |
| Indica II | 465 | 27.70% | 4.90% | 3.23% | 64.09% | NA |
| Indica III | 913 | 84.80% | 0.70% | 0.99% | 13.58% | NA |
| Indica Intermediate | 786 | 42.50% | 6.70% | 2.42% | 48.35% | NA |
| Temperate Japonica | 767 | 2.50% | 96.10% | 0.00% | 1.43% | NA |
| Tropical Japonica | 504 | 17.10% | 82.10% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 7.10% | 91.70% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 63.50% | 4.20% | 1.04% | 31.25% | NA |
| Intermediate | 90 | 38.90% | 38.90% | 1.11% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614714911 | A -> T | LOC_Os06g25140.1 | downstream_gene_variant ; 4534.0bp to feature; MODIFIER | silent_mutation | Average:25.121; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg0614714911 | A -> T | LOC_Os06g25150.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.121; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| vg0614714911 | A -> DEL | N | N | silent_mutation | Average:25.121; most accessible tissue: Minghui63 flag leaf, score: 57.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614714911 | NA | 6.09E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614714911 | 4.77E-07 | 4.91E-09 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614714911 | 1.04E-06 | NA | mr1218 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |