\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614703627:

Variant ID: vg0614703627 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14703627
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGGAAAGCTAATATGAGGCAGTTGGTGGCAAGATAGAAGTAAATGACAAGCATGATATTCTCACGATGACAAGCCTGGTATCCTAGTAATGACAAGCT[G/A]
ATATCGACGCATAACGTGAAGTGGGTAACTTATATGAGGTTGACACCAAAGATATGAATTATGAGAAGTTCTGGAACTGAAGTCCCATCTTCAAGTGCCG

Reverse complement sequence

CGGCACTTGAAGATGGGACTTCAGTTCCAGAACTTCTCATAATTCATATCTTTGGTGTCAACCTCATATAAGTTACCCACTTCACGTTATGCGTCGATAT[C/T]
AGCTTGTCATTACTAGGATACCAGGCTTGTCATCGTGAGAATATCATGCTTGTCATTTACTTCTATCTTGCCACCAACTGCCTCATATTAGCTTTCCTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.50% 31.40% 8.19% 23.83% NA
All Indica  2759 4.20% 47.00% 11.05% 37.73% NA
All Japonica  1512 90.90% 7.90% 0.13% 1.12% NA
Aus  269 71.00% 16.00% 4.09% 8.92% NA
Indica I  595 6.20% 12.40% 26.22% 55.13% NA
Indica II  465 3.20% 28.00% 6.67% 62.15% NA
Indica III  913 0.50% 84.40% 3.07% 11.94% NA
Indica Intermediate  786 7.40% 41.10% 11.45% 40.08% NA
Temperate Japonica  767 96.20% 2.50% 0.00% 1.30% NA
Tropical Japonica  504 82.30% 16.90% 0.00% 0.79% NA
Japonica Intermediate  241 91.70% 6.20% 0.83% 1.24% NA
VI/Aromatic  96 8.30% 5.20% 62.50% 23.96% NA
Intermediate  90 43.30% 23.30% 10.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614703627 G -> A LOC_Os06g25130.1 upstream_gene_variant ; 1203.0bp to feature; MODIFIER silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0614703627 G -> A LOC_Os06g25140.1 upstream_gene_variant ; 4963.0bp to feature; MODIFIER silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0614703627 G -> A LOC_Os06g25120.1 downstream_gene_variant ; 1520.0bp to feature; MODIFIER silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0614703627 G -> A LOC_Os06g25120-LOC_Os06g25130 intergenic_region ; MODIFIER silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0614703627 G -> DEL N N silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614703627 3.21E-06 NA mr1006 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 2.45E-06 NA mr1037 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 5.02E-06 NA mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 7.93E-07 NA mr1052 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 NA 6.48E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 NA 1.08E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 NA 1.95E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 NA 4.43E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 NA 6.01E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627 NA 7.34E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251