\
| Variant ID: vg0614703627 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14703627 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 104. )
CCAGGAAAGCTAATATGAGGCAGTTGGTGGCAAGATAGAAGTAAATGACAAGCATGATATTCTCACGATGACAAGCCTGGTATCCTAGTAATGACAAGCT[G/A]
ATATCGACGCATAACGTGAAGTGGGTAACTTATATGAGGTTGACACCAAAGATATGAATTATGAGAAGTTCTGGAACTGAAGTCCCATCTTCAAGTGCCG
CGGCACTTGAAGATGGGACTTCAGTTCCAGAACTTCTCATAATTCATATCTTTGGTGTCAACCTCATATAAGTTACCCACTTCACGTTATGCGTCGATAT[C/T]
AGCTTGTCATTACTAGGATACCAGGCTTGTCATCGTGAGAATATCATGCTTGTCATTTACTTCTATCTTGCCACCAACTGCCTCATATTAGCTTTCCTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.50% | 31.40% | 8.19% | 23.83% | NA |
| All Indica | 2759 | 4.20% | 47.00% | 11.05% | 37.73% | NA |
| All Japonica | 1512 | 90.90% | 7.90% | 0.13% | 1.12% | NA |
| Aus | 269 | 71.00% | 16.00% | 4.09% | 8.92% | NA |
| Indica I | 595 | 6.20% | 12.40% | 26.22% | 55.13% | NA |
| Indica II | 465 | 3.20% | 28.00% | 6.67% | 62.15% | NA |
| Indica III | 913 | 0.50% | 84.40% | 3.07% | 11.94% | NA |
| Indica Intermediate | 786 | 7.40% | 41.10% | 11.45% | 40.08% | NA |
| Temperate Japonica | 767 | 96.20% | 2.50% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 82.30% | 16.90% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 91.70% | 6.20% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 8.30% | 5.20% | 62.50% | 23.96% | NA |
| Intermediate | 90 | 43.30% | 23.30% | 10.00% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614703627 | G -> A | LOC_Os06g25130.1 | upstream_gene_variant ; 1203.0bp to feature; MODIFIER | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0614703627 | G -> A | LOC_Os06g25140.1 | upstream_gene_variant ; 4963.0bp to feature; MODIFIER | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0614703627 | G -> A | LOC_Os06g25120.1 | downstream_gene_variant ; 1520.0bp to feature; MODIFIER | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0614703627 | G -> A | LOC_Os06g25120-LOC_Os06g25130 | intergenic_region ; MODIFIER | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0614703627 | G -> DEL | N | N | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614703627 | 3.21E-06 | NA | mr1006 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | NA | 2.80E-06 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | 2.45E-06 | NA | mr1037 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | 5.02E-06 | NA | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | 7.93E-07 | NA | mr1052 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | NA | 6.48E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | NA | 1.08E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | NA | 1.95E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | NA | 4.43E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | NA | 6.01E-10 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614703627 | NA | 7.34E-06 | mr1876 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |