Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614703627:

Variant ID: vg0614703627 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14703627
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CCAGGAAAGCTAATATGAGGCAGTTGGTGGCAAGATAGAAGTAAATGACAAGCATGATATTCTCACGATGACAAGCCTGGTATCCTAGTAATGACAAGCT[G/A]
ATATCGACGCATAACGTGAAGTGGGTAACTTATATGAGGTTGACACCAAAGATATGAATTATGAGAAGTTCTGGAACTGAAGTCCCATCTTCAAGTGCCG

Reverse complement sequence

CGGCACTTGAAGATGGGACTTCAGTTCCAGAACTTCTCATAATTCATATCTTTGGTGTCAACCTCATATAAGTTACCCACTTCACGTTATGCGTCGATAT[C/T]
AGCTTGTCATTACTAGGATACCAGGCTTGTCATCGTGAGAATATCATGCTTGTCATTTACTTCTATCTTGCCACCAACTGCCTCATATTAGCTTTCCTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.50%	31.40%	8.19%	23.83%	NA
All Indica	2759	4.20%	47.00%	11.05%	37.73%	NA
All Japonica	1512	90.90%	7.90%	0.13%	1.12%	NA
Aus	269	71.00%	16.00%	4.09%	8.92%	NA
Indica I	595	6.20%	12.40%	26.22%	55.13%	NA
Indica II	465	3.20%	28.00%	6.67%	62.15%	NA
Indica III	913	0.50%	84.40%	3.07%	11.94%	NA
Indica Intermediate	786	7.40%	41.10%	11.45%	40.08%	NA
Temperate Japonica	767	96.20%	2.50%	0.00%	1.30%	NA
Tropical Japonica	504	82.30%	16.90%	0.00%	0.79%	NA
Japonica Intermediate	241	91.70%	6.20%	0.83%	1.24%	NA
VI/Aromatic	96	8.30%	5.20%	62.50%	23.96%	NA
Intermediate	90	43.30%	23.30%	10.00%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614703627	G -> A	LOC_Os06g25130.1	upstream_gene_variant ; 1203.0bp to feature; MODIFIER	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0614703627	G -> A	LOC_Os06g25140.1	upstream_gene_variant ; 4963.0bp to feature; MODIFIER	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0614703627	G -> A	LOC_Os06g25120.1	downstream_gene_variant ; 1520.0bp to feature; MODIFIER	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0614703627	G -> A	LOC_Os06g25120-LOC_Os06g25130	intergenic_region ; MODIFIER	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0614703627	G -> DEL	N	N	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614703627	3.21E-06	NA	mr1006	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	NA	2.80E-06	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	2.45E-06	NA	mr1037	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	5.02E-06	NA	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	7.93E-07	NA	mr1052	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	NA	6.48E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	NA	1.08E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	NA	1.95E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	NA	4.43E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	NA	6.01E-10	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614703627	NA	7.34E-06	mr1876	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251