\
| Variant ID: vg0614629248 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14629248 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, T: 0.22, others allele: 0.00, population size: 45. )
ATATCGGACAAAATCCAAAAATCATCTTATAATATTGTACGATTTAATTTAGTCTATGATTAAACGATTAAATATAACACACGGCTAAAATCCGTAGTAA[T/A]
TAAATCCGAATTTCTACCGTGAATCGATTACTTATAGAGATTACCCAAAAATAATCTATAAGAATTCATCTATTTGTTTAGTTATTAATTACATCTAAAT
ATTTAGATGTAATTAATAACTAAACAAATAGATGAATTCTTATAGATTATTTTTGGGTAATCTCTATAAGTAATCGATTCACGGTAGAAATTCGGATTTA[A/T]
TTACTACGGATTTTAGCCGTGTGTTATATTTAATCGTTTAATCATAGACTAAATTAAATCGTACAATATTATAAGATGATTTTTGGATTTTGTCCGATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.70% | 32.40% | 8.44% | 15.47% | NA |
| All Indica | 2759 | 59.20% | 4.30% | 12.25% | 24.28% | NA |
| All Japonica | 1512 | 7.30% | 90.90% | 0.79% | 0.99% | NA |
| Aus | 269 | 79.90% | 1.10% | 14.87% | 4.09% | NA |
| Indica I | 595 | 39.30% | 8.10% | 15.13% | 37.48% | NA |
| Indica II | 465 | 46.20% | 3.40% | 12.90% | 37.42% | NA |
| Indica III | 913 | 85.10% | 0.80% | 6.68% | 7.45% | NA |
| Indica Intermediate | 786 | 51.70% | 6.10% | 16.16% | 26.08% | NA |
| Temperate Japonica | 767 | 1.40% | 96.30% | 0.78% | 1.43% | NA |
| Tropical Japonica | 504 | 16.70% | 82.10% | 0.99% | 0.20% | NA |
| Japonica Intermediate | 241 | 6.20% | 92.10% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 70.80% | 3.10% | 2.08% | 23.96% | NA |
| Intermediate | 90 | 43.30% | 35.60% | 7.78% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614629248 | T -> A | LOC_Os06g24960.1 | upstream_gene_variant ; 3798.0bp to feature; MODIFIER | silent_mutation | Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0614629248 | T -> A | LOC_Os06g24970.1 | upstream_gene_variant ; 2255.0bp to feature; MODIFIER | silent_mutation | Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0614629248 | T -> A | LOC_Os06g24970-LOC_Os06g24990 | intergenic_region ; MODIFIER | silent_mutation | Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0614629248 | T -> DEL | N | N | silent_mutation | Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614629248 | NA | 2.80E-06 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629248 | 3.22E-07 | 3.22E-07 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629248 | 6.04E-06 | NA | mr1167 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629248 | 2.42E-06 | NA | mr1399 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629248 | 4.67E-06 | NA | mr1479 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629248 | 5.17E-07 | NA | mr1502 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629248 | 5.78E-06 | NA | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629248 | 5.26E-06 | NA | mr1675 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614629248 | NA | 1.28E-07 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |