Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0614629248:

Variant ID: vg0614629248 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14629248
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, T: 0.22, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

ATATCGGACAAAATCCAAAAATCATCTTATAATATTGTACGATTTAATTTAGTCTATGATTAAACGATTAAATATAACACACGGCTAAAATCCGTAGTAA[T/A]
TAAATCCGAATTTCTACCGTGAATCGATTACTTATAGAGATTACCCAAAAATAATCTATAAGAATTCATCTATTTGTTTAGTTATTAATTACATCTAAAT

Reverse complement sequence

ATTTAGATGTAATTAATAACTAAACAAATAGATGAATTCTTATAGATTATTTTTGGGTAATCTCTATAAGTAATCGATTCACGGTAGAAATTCGGATTTA[A/T]
TTACTACGGATTTTAGCCGTGTGTTATATTTAATCGTTTAATCATAGACTAAATTAAATCGTACAATATTATAAGATGATTTTTGGATTTTGTCCGATAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.70%	32.40%	8.44%	15.47%	NA
All Indica	2759	59.20%	4.30%	12.25%	24.28%	NA
All Japonica	1512	7.30%	90.90%	0.79%	0.99%	NA
Aus	269	79.90%	1.10%	14.87%	4.09%	NA
Indica I	595	39.30%	8.10%	15.13%	37.48%	NA
Indica II	465	46.20%	3.40%	12.90%	37.42%	NA
Indica III	913	85.10%	0.80%	6.68%	7.45%	NA
Indica Intermediate	786	51.70%	6.10%	16.16%	26.08%	NA
Temperate Japonica	767	1.40%	96.30%	0.78%	1.43%	NA
Tropical Japonica	504	16.70%	82.10%	0.99%	0.20%	NA
Japonica Intermediate	241	6.20%	92.10%	0.41%	1.24%	NA
VI/Aromatic	96	70.80%	3.10%	2.08%	23.96%	NA
Intermediate	90	43.30%	35.60%	7.78%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614629248	T -> A	LOC_Os06g24960.1	upstream_gene_variant ; 3798.0bp to feature; MODIFIER	silent_mutation	Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0614629248	T -> A	LOC_Os06g24970.1	upstream_gene_variant ; 2255.0bp to feature; MODIFIER	silent_mutation	Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0614629248	T -> A	LOC_Os06g24970-LOC_Os06g24990	intergenic_region ; MODIFIER	silent_mutation	Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0614629248	T -> DEL	N	N	silent_mutation	Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614629248	NA	2.80E-06	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248	3.22E-07	3.22E-07	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248	6.04E-06	NA	mr1167	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248	2.42E-06	NA	mr1399	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248	4.67E-06	NA	mr1479	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248	5.17E-07	NA	mr1502	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248	5.78E-06	NA	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248	5.26E-06	NA	mr1675	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248	NA	1.28E-07	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251