\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614629248:

Variant ID: vg0614629248 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14629248
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, T: 0.22, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


ATATCGGACAAAATCCAAAAATCATCTTATAATATTGTACGATTTAATTTAGTCTATGATTAAACGATTAAATATAACACACGGCTAAAATCCGTAGTAA[T/A]
TAAATCCGAATTTCTACCGTGAATCGATTACTTATAGAGATTACCCAAAAATAATCTATAAGAATTCATCTATTTGTTTAGTTATTAATTACATCTAAAT

Reverse complement sequence

ATTTAGATGTAATTAATAACTAAACAAATAGATGAATTCTTATAGATTATTTTTGGGTAATCTCTATAAGTAATCGATTCACGGTAGAAATTCGGATTTA[A/T]
TTACTACGGATTTTAGCCGTGTGTTATATTTAATCGTTTAATCATAGACTAAATTAAATCGTACAATATTATAAGATGATTTTTGGATTTTGTCCGATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.70% 32.40% 8.44% 15.47% NA
All Indica  2759 59.20% 4.30% 12.25% 24.28% NA
All Japonica  1512 7.30% 90.90% 0.79% 0.99% NA
Aus  269 79.90% 1.10% 14.87% 4.09% NA
Indica I  595 39.30% 8.10% 15.13% 37.48% NA
Indica II  465 46.20% 3.40% 12.90% 37.42% NA
Indica III  913 85.10% 0.80% 6.68% 7.45% NA
Indica Intermediate  786 51.70% 6.10% 16.16% 26.08% NA
Temperate Japonica  767 1.40% 96.30% 0.78% 1.43% NA
Tropical Japonica  504 16.70% 82.10% 0.99% 0.20% NA
Japonica Intermediate  241 6.20% 92.10% 0.41% 1.24% NA
VI/Aromatic  96 70.80% 3.10% 2.08% 23.96% NA
Intermediate  90 43.30% 35.60% 7.78% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614629248 T -> A LOC_Os06g24960.1 upstream_gene_variant ; 3798.0bp to feature; MODIFIER silent_mutation Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0614629248 T -> A LOC_Os06g24970.1 upstream_gene_variant ; 2255.0bp to feature; MODIFIER silent_mutation Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0614629248 T -> A LOC_Os06g24970-LOC_Os06g24990 intergenic_region ; MODIFIER silent_mutation Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0614629248 T -> DEL N N silent_mutation Average:8.662; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614629248 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248 3.22E-07 3.22E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248 6.04E-06 NA mr1167 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248 2.42E-06 NA mr1399 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248 4.67E-06 NA mr1479 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248 5.17E-07 NA mr1502 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248 5.78E-06 NA mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248 5.26E-06 NA mr1675 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614629248 NA 1.28E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251