\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614471821:

Variant ID: vg0614471821 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14471821
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GTACTGTTCATGCTTGTTTATGTGCTGTTTTGGTGATTTTGCTCTTTTCTCTTTAGATTCCGACGTTCCCGGAGAGTCCGAATTTACAGGAGAAGACTTT[G/A]
AAGAGTTACAAGGCCAGCAAGGCAAGTCACACAGATCCCAAAAAACCCTTTGAGCATGTTGATTCTGTTTAAAGCTATTATTTCTATTCAACTATTGCAT

Reverse complement sequence

ATGCAATAGTTGAATAGAAATAATAGCTTTAAACAGAATCAACATGCTCAAAGGGTTTTTTGGGATCTGTGTGACTTGCCTTGCTGGCCTTGTAACTCTT[C/T]
AAAGTCTTCTCCTGTAAATTCGGACTCTCCGGGAACGTCGGAATCTAAAGAGAAAAGAGCAAAATCACCAAAACAGCACATAAACAAGCATGAACAGTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.70% 1.00% 24.74% 34.55% NA
All Indica  2759 5.60% 1.70% 39.87% 52.81% NA
All Japonica  1512 91.60% 0.00% 0.93% 7.47% NA
Aus  269 73.60% 0.40% 9.29% 16.73% NA
Indica I  595 6.90% 2.20% 55.29% 35.63% NA
Indica II  465 3.70% 3.70% 60.22% 32.47% NA
Indica III  913 2.20% 0.40% 14.90% 82.48% NA
Indica Intermediate  786 9.80% 1.70% 45.17% 43.38% NA
Temperate Japonica  767 96.50% 0.00% 1.17% 2.35% NA
Tropical Japonica  504 83.50% 0.00% 0.60% 15.87% NA
Japonica Intermediate  241 92.90% 0.00% 0.83% 6.22% NA
VI/Aromatic  96 88.50% 0.00% 9.38% 2.08% NA
Intermediate  90 57.80% 1.10% 23.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614471821 G -> A LOC_Os06g24640.1 upstream_gene_variant ; 2838.0bp to feature; MODIFIER silent_mutation Average:9.552; most accessible tissue: Callus, score: 33.752 N N N N
vg0614471821 G -> A LOC_Os06g24650.1 upstream_gene_variant ; 2459.0bp to feature; MODIFIER silent_mutation Average:9.552; most accessible tissue: Callus, score: 33.752 N N N N
vg0614471821 G -> A LOC_Os06g24640-LOC_Os06g24650 intergenic_region ; MODIFIER silent_mutation Average:9.552; most accessible tissue: Callus, score: 33.752 N N N N
vg0614471821 G -> DEL N N silent_mutation Average:9.552; most accessible tissue: Callus, score: 33.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614471821 NA 5.83E-45 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 1.09E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 4.22E-11 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 1.12E-39 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 9.74E-44 mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 2.35E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 3.31E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 2.37E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 8.22E-11 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 3.02E-21 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 1.53E-36 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 6.85E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 4.84E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 6.59E-08 mr1496_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 1.37E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 3.31E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 1.20E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 5.58E-08 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 1.13E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471821 NA 1.92E-22 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251