| Variant ID: vg0614471821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14471821 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )
GTACTGTTCATGCTTGTTTATGTGCTGTTTTGGTGATTTTGCTCTTTTCTCTTTAGATTCCGACGTTCCCGGAGAGTCCGAATTTACAGGAGAAGACTTT[G/A]
AAGAGTTACAAGGCCAGCAAGGCAAGTCACACAGATCCCAAAAAACCCTTTGAGCATGTTGATTCTGTTTAAAGCTATTATTTCTATTCAACTATTGCAT
ATGCAATAGTTGAATAGAAATAATAGCTTTAAACAGAATCAACATGCTCAAAGGGTTTTTTGGGATCTGTGTGACTTGCCTTGCTGGCCTTGTAACTCTT[C/T]
AAAGTCTTCTCCTGTAAATTCGGACTCTCCGGGAACGTCGGAATCTAAAGAGAAAAGAGCAAAATCACCAAAACAGCACATAAACAAGCATGAACAGTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 1.00% | 24.74% | 34.55% | NA |
| All Indica | 2759 | 5.60% | 1.70% | 39.87% | 52.81% | NA |
| All Japonica | 1512 | 91.60% | 0.00% | 0.93% | 7.47% | NA |
| Aus | 269 | 73.60% | 0.40% | 9.29% | 16.73% | NA |
| Indica I | 595 | 6.90% | 2.20% | 55.29% | 35.63% | NA |
| Indica II | 465 | 3.70% | 3.70% | 60.22% | 32.47% | NA |
| Indica III | 913 | 2.20% | 0.40% | 14.90% | 82.48% | NA |
| Indica Intermediate | 786 | 9.80% | 1.70% | 45.17% | 43.38% | NA |
| Temperate Japonica | 767 | 96.50% | 0.00% | 1.17% | 2.35% | NA |
| Tropical Japonica | 504 | 83.50% | 0.00% | 0.60% | 15.87% | NA |
| Japonica Intermediate | 241 | 92.90% | 0.00% | 0.83% | 6.22% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 9.38% | 2.08% | NA |
| Intermediate | 90 | 57.80% | 1.10% | 23.33% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614471821 | G -> A | LOC_Os06g24640.1 | upstream_gene_variant ; 2838.0bp to feature; MODIFIER | silent_mutation | Average:9.552; most accessible tissue: Callus, score: 33.752 | N | N | N | N |
| vg0614471821 | G -> A | LOC_Os06g24650.1 | upstream_gene_variant ; 2459.0bp to feature; MODIFIER | silent_mutation | Average:9.552; most accessible tissue: Callus, score: 33.752 | N | N | N | N |
| vg0614471821 | G -> A | LOC_Os06g24640-LOC_Os06g24650 | intergenic_region ; MODIFIER | silent_mutation | Average:9.552; most accessible tissue: Callus, score: 33.752 | N | N | N | N |
| vg0614471821 | G -> DEL | N | N | silent_mutation | Average:9.552; most accessible tissue: Callus, score: 33.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614471821 | NA | 5.83E-45 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614471821 | NA | 1.09E-09 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614471821 | NA | 4.22E-11 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614471821 | NA | 1.12E-39 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614471821 | NA | 9.74E-44 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614471821 | NA | 2.35E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614471821 | NA | 3.31E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614471821 | NA | 2.37E-16 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614471821 | NA | 8.22E-11 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614471821 | NA | 3.02E-21 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/