Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614471183:

Variant ID: vg0614471183 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14471183
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

AAATAGCCACAAACCGTCCTTGTGTTCCCCTTGCACGTCTGCATCGTTGGTGTGGCTTGTTGAGTACGGTGGTTGTACTCAGCCTTGCTATTATTCCCCC[A/T]
TTTCAGAAGTGTAGTGCTTCTGAGCTGAAGACGAAGTTAGAAGACCAAGGCTCAGACCCCAGTTGAGTTTTGCCTGTGGAGTGAAGCTAGGATCGCCTTT

Reverse complement sequence

AAAGGCGATCCTAGCTTCACTCCACAGGCAAAACTCAACTGGGGTCTGAGCCTTGGTCTTCTAACTTCGTCTTCAGCTCAGAAGCACTACACTTCTGAAA[T/A]
GGGGGAATAATAGCAAGGCTGAGTACAACCACCGTACTCAACAAGCCACACCAACGATGCAGACGTGCAAGGGGAACACAAGGACGGTTTGTGGCTATTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.00%	12.20%	23.55%	45.26%	NA
All Indica	2759	2.00%	1.40%	30.19%	66.47%	NA
All Japonica	1512	54.90%	34.40%	4.89%	5.82%	NA
Aus	269	0.00%	1.10%	45.72%	53.16%	NA
Indica I	595	3.70%	0.20%	20.00%	76.13%	NA
Indica II	465	1.30%	1.10%	33.76%	63.87%	NA
Indica III	913	0.50%	0.70%	32.64%	66.16%	NA
Indica Intermediate	786	2.70%	3.30%	32.95%	61.07%	NA
Temperate Japonica	767	89.60%	5.20%	2.61%	2.61%	NA
Tropical Japonica	504	6.70%	74.20%	8.73%	10.32%	NA
Japonica Intermediate	241	45.20%	44.00%	4.15%	6.64%	NA
VI/Aromatic	96	1.00%	0.00%	56.25%	42.71%	NA
Intermediate	90	14.40%	16.70%	32.22%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614471183	A -> T	LOC_Os06g24640.1	upstream_gene_variant ; 2200.0bp to feature; MODIFIER	silent_mutation	Average:7.11; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0614471183	A -> T	LOC_Os06g24650.1	upstream_gene_variant ; 3097.0bp to feature; MODIFIER	silent_mutation	Average:7.11; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0614471183	A -> T	LOC_Os06g24640-LOC_Os06g24650	intergenic_region ; MODIFIER	silent_mutation	Average:7.11; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0614471183	A -> DEL	N	N	silent_mutation	Average:7.11; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614471183	NA	6.45E-10	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	5.16E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	3.89E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	1.14E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	3.77E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	6.07E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	1.61E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	7.08E-09	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	1.39E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	4.82E-07	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	2.47E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	2.29E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	7.69E-06	NA	mr1546_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	4.29E-06	NA	mr1546_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	5.20E-09	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	3.15E-07	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	7.24E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	1.05E-06	NA	mr1712_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	3.01E-08	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	6.22E-06	mr1786_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614471183	NA	1.43E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251