Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614455569:

Variant ID: vg0614455569 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14455569
Reference Allele: T	Alternative Allele: A,C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAATCAGCCGAGGCACACAATAACAAATTGATAATAGAGTACAAATAAATGACTATTTAATATTCGCAAATAATAAATTATTACAGAGGTGGATAGTT[T/A,C]
CTCTCAAAGAATAACATTCTACGCAGCGGAAAGAAATAAACTAAAGCAAACTACGGAACAAATATGGCGACTCCACTCCACAAGCATCTTAACCCGAACC

Reverse complement sequence

GGTTCGGGTTAAGATGCTTGTGGAGTGGAGTCGCCATATTTGTTCCGTAGTTTGCTTTAGTTTATTTCTTTCCGCTGCGTAGAATGTTATTCTTTGAGAG[A/T,G]
AACTATCCACCTCTGTAATAATTTATTATTTGCGAATATTAAATAGTCATTTATTTGTACTCTATTATCAATTTGTTATTGTGTGCCTCGGCTGATTCCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.50%	7.80%	23.55%	35.15%	NA
All Indica	2759	5.90%	2.80%	38.35%	52.99%	NA
All Japonica	1512	91.30%	0.30%	0.26%	8.20%	NA
Aus	269	1.50%	69.50%	13.38%	15.61%	NA
Indica I	595	11.40%	2.90%	10.25%	75.46%	NA
Indica II	465	3.20%	1.30%	33.55%	61.94%	NA
Indica III	913	1.90%	2.70%	63.09%	32.31%	NA
Indica Intermediate	786	8.00%	3.60%	33.72%	54.71%	NA
Temperate Japonica	767	96.60%	0.00%	0.26%	3.13%	NA
Tropical Japonica	504	82.90%	0.20%	0.40%	16.47%	NA
Japonica Intermediate	241	91.70%	1.20%	0.00%	7.05%	NA
VI/Aromatic	96	1.00%	87.50%	0.00%	11.46%	NA
Intermediate	90	41.10%	17.80%	16.67%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614455569	T -> C	LOC_Os06g24620.1	upstream_gene_variant ; 2246.0bp to feature; MODIFIER	silent_mutation	Average:14.12; most accessible tissue: Zhenshan97 young leaf, score: 26.435	N	N	N	N
vg0614455569	T -> C	LOC_Os06g24630.1	upstream_gene_variant ; 4838.0bp to feature; MODIFIER	silent_mutation	Average:14.12; most accessible tissue: Zhenshan97 young leaf, score: 26.435	N	N	N	N
vg0614455569	T -> C	LOC_Os06g24610-LOC_Os06g24620	intergenic_region ; MODIFIER	silent_mutation	Average:14.12; most accessible tissue: Zhenshan97 young leaf, score: 26.435	N	N	N	N
vg0614455569	T -> A	LOC_Os06g24620.1	upstream_gene_variant ; 2246.0bp to feature; MODIFIER	N	Average:14.12; most accessible tissue: Zhenshan97 young leaf, score: 26.435	N	N	N	N
vg0614455569	T -> A	LOC_Os06g24630.1	upstream_gene_variant ; 4838.0bp to feature; MODIFIER	N	Average:14.12; most accessible tissue: Zhenshan97 young leaf, score: 26.435	N	N	N	N
vg0614455569	T -> A	LOC_Os06g24610-LOC_Os06g24620	intergenic_region ; MODIFIER	N	Average:14.12; most accessible tissue: Zhenshan97 young leaf, score: 26.435	N	N	N	N
vg0614455569	T -> DEL	N	N	silent_mutation	Average:14.12; most accessible tissue: Zhenshan97 young leaf, score: 26.435	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614455569	NA	3.29E-14	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614455569	NA	8.47E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614455569	NA	1.02E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614455569	NA	1.58E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614455569	NA	7.38E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614455569	NA	5.81E-11	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614455569	2.44E-06	2.44E-06	mr1978	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614455569	NA	2.85E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614455569	NA	1.19E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614455569	NA	3.75E-13	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251