\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614347196:

Variant ID: vg0614347196 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 14347196
Reference Allele: CACTGTAlternative Allele: TACTGT,C
Primary Allele: CACTGTSecondary Allele: TACTGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAATTACATGTAATAAATGGGACCACATATACATTTGTTGATAAATTTTCTCCTAAAAATTTAACAGATGTAATTATAGTACAATTATAGTGTAATTA[CACTGT/TACTGT,C]
AACTTGCATGTAACTACAGTGTAACTTGTATGTAAGTTTCACGTAATTTTGAATCGTTAAATCTATTACTCCCTCTATTTTATAATATAAGTCATTTTAG

Reverse complement sequence

CTAAAATGACTTATATTATAAAATAGAGGGAGTAATAGATTTAACGATTCAAAATTACGTGAAACTTACATACAAGTTACACTGTAGTTACATGCAAGTT[ACAGTG/ACAGTA,G]
TAATTACACTATAATTGTACTATAATTACATCTGTTAAATTTTTAGGAGAAAATTTATCAACAAATGTATATGTGGTCCCATTTATTACATGTAATTGAT

Allele Frequencies:

Populations Population SizeFrequency of CACTGT(primary allele) Frequency of TACTGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 2.40% 3.55% 1.29% C: 0.02%
All Indica  2759 89.80% 4.20% 5.91% 0.07% C: 0.04%
All Japonica  1512 99.70% 0.00% 0.13% 0.13% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 70.90% 10.90% 18.15% 0.00% NA
Indica II  465 91.40% 2.80% 5.81% 0.00% NA
Indica III  913 99.80% 0.00% 0.00% 0.11% C: 0.11%
Indica Intermediate  786 91.60% 4.70% 3.56% 0.13% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 43.80% 0.00% 0.00% 56.25% NA
Intermediate  90 95.60% 0.00% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614347196 CACTGT -> TACTGT LOC_Os06g24490.1 3_prime_UTR_variant ; 252.0bp to feature; MODIFIER silent_mutation Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543 N N N N
vg0614347196 CACTGT -> TACTGT LOC_Os06g24480.1 upstream_gene_variant ; 3923.0bp to feature; MODIFIER silent_mutation Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543 N N N N
vg0614347196 CACTGT -> TACTGT LOC_Os06g24500.1 downstream_gene_variant ; 4732.0bp to feature; MODIFIER silent_mutation Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543 N N N N
vg0614347196 CACTGT -> DEL N N silent_mutation Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543 N N N N
vg0614347196 CACTGT -> C LOC_Os06g24490.1 3_prime_UTR_variant ; 247.0bp to feature; MODIFIER silent_mutation Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543 N N N N
vg0614347196 CACTGT -> C LOC_Os06g24480.1 upstream_gene_variant ; 3924.0bp to feature; MODIFIER silent_mutation Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543 N N N N
vg0614347196 CACTGT -> C LOC_Os06g24500.1 downstream_gene_variant ; 4731.0bp to feature; MODIFIER silent_mutation Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0614347196 CACTG* C 0.07 -0.03 0.01 0.09 0.0 0.07
vg0614347196 CACTG* TACTG* 0.02 0.03 0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614347196 NA 2.95E-07 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196 NA 6.40E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196 NA 3.07E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196 NA 3.09E-10 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196 NA 2.75E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196 NA 1.72E-10 mr1002_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196 NA 8.50E-10 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196 NA 2.63E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196 NA 1.11E-10 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196 NA 2.28E-09 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251