Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614347196:

Variant ID: vg0614347196 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 14347196
Reference Allele: CACTGT	Alternative Allele: TACTGT,C
Primary Allele: CACTGT	Secondary Allele: TACTGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCAATTACATGTAATAAATGGGACCACATATACATTTGTTGATAAATTTTCTCCTAAAAATTTAACAGATGTAATTATAGTACAATTATAGTGTAATTA[CACTGT/TACTGT,C]
AACTTGCATGTAACTACAGTGTAACTTGTATGTAAGTTTCACGTAATTTTGAATCGTTAAATCTATTACTCCCTCTATTTTATAATATAAGTCATTTTAG

Reverse complement sequence

CTAAAATGACTTATATTATAAAATAGAGGGAGTAATAGATTTAACGATTCAAAATTACGTGAAACTTACATACAAGTTACACTGTAGTTACATGCAAGTT[ACAGTG/ACAGTA,G]
TAATTACACTATAATTGTACTATAATTACATCTGTTAAATTTTTAGGAGAAAATTTATCAACAAATGTATATGTGGTCCCATTTATTACATGTAATTGAT

Allele Frequencies:

Populations	Population Size	Frequency of CACTGT(primary allele)	Frequency of TACTGT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	2.40%	3.55%	1.29%	C: 0.02%
All Indica	2759	89.80%	4.20%	5.91%	0.07%	C: 0.04%
All Japonica	1512	99.70%	0.00%	0.13%	0.13%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	70.90%	10.90%	18.15%	0.00%	NA
Indica II	465	91.40%	2.80%	5.81%	0.00%	NA
Indica III	913	99.80%	0.00%	0.00%	0.11%	C: 0.11%
Indica Intermediate	786	91.60%	4.70%	3.56%	0.13%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	43.80%	0.00%	0.00%	56.25%	NA
Intermediate	90	95.60%	0.00%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614347196	CACTGT -> TACTGT	LOC_Os06g24490.1	3_prime_UTR_variant ; 252.0bp to feature; MODIFIER	silent_mutation	Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543	N	N	N	N
vg0614347196	CACTGT -> TACTGT	LOC_Os06g24480.1	upstream_gene_variant ; 3923.0bp to feature; MODIFIER	silent_mutation	Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543	N	N	N	N
vg0614347196	CACTGT -> TACTGT	LOC_Os06g24500.1	downstream_gene_variant ; 4732.0bp to feature; MODIFIER	silent_mutation	Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543	N	N	N	N
vg0614347196	CACTGT -> DEL	N	N	silent_mutation	Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543	N	N	N	N
vg0614347196	CACTGT -> C	LOC_Os06g24490.1	3_prime_UTR_variant ; 247.0bp to feature; MODIFIER	silent_mutation	Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543	N	N	N	N
vg0614347196	CACTGT -> C	LOC_Os06g24480.1	upstream_gene_variant ; 3924.0bp to feature; MODIFIER	silent_mutation	Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543	N	N	N	N
vg0614347196	CACTGT -> C	LOC_Os06g24500.1	downstream_gene_variant ; 4731.0bp to feature; MODIFIER	silent_mutation	Average:79.407; most accessible tissue: Zhenshan97 root, score: 95.543	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0614347196	CACTG*	C	0.07	-0.03	0.01	0.09	0.0	0.07
vg0614347196	CACTG*	TACTG*	0.02	0.03	0.01	-0.01	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614347196	NA	2.95E-07	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196	NA	6.40E-08	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196	NA	3.07E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196	NA	3.09E-10	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196	NA	2.75E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196	NA	1.72E-10	mr1002_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196	NA	8.50E-10	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196	NA	2.63E-08	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196	NA	1.11E-10	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614347196	NA	2.28E-09	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251