\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614300581:

Variant ID: vg0614300581 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14300581
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATGAGTTGTACAACTTTTATGTTCATGACTTTTCAGCTGAAATTATTTACTGCTTCAAAATATTATTTGAAGTTTTAAAATTCAAATTTTTAATTGAT[A/T]
AAACAAAGTCATAAGAAAAAATGGCCAAAATAATAGCAGTAAAAACATAATAACATGATAGAGCATAATTTAGAAACACAATAGCAAAAATCGTTTGTTA

Reverse complement sequence

TAACAAACGATTTTTGCTATTGTGTTTCTAAATTATGCTCTATCATGTTATTATGTTTTTACTGCTATTATTTTGGCCATTTTTTCTTATGACTTTGTTT[T/A]
ATCAATTAAAAATTTGAATTTTAAAACTTCAAATAATATTTTGAAGCAGTAAATAATTTCAGCTGAAAAGTCATGAACATAAAAGTTGTACAACTCATCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 33.70% 0.36% 1.63% NA
All Indica  2759 97.20% 2.30% 0.43% 0.07% NA
All Japonica  1512 9.10% 90.80% 0.00% 0.13% NA
Aus  269 59.50% 40.50% 0.00% 0.00% NA
Indica I  595 95.80% 2.50% 1.68% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 99.60% 0.30% 0.00% 0.11% NA
Indica Intermediate  786 94.90% 4.80% 0.13% 0.13% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 17.90% 82.10% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 91.70% 0.00% 0.83% NA
VI/Aromatic  96 15.60% 8.30% 5.21% 70.83% NA
Intermediate  90 51.10% 43.30% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614300581 A -> T LOC_Os06g24420.1 upstream_gene_variant ; 1331.0bp to feature; MODIFIER silent_mutation Average:20.996; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0614300581 A -> T LOC_Os06g24404-LOC_Os06g24420 intergenic_region ; MODIFIER silent_mutation Average:20.996; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0614300581 A -> DEL N N silent_mutation Average:20.996; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614300581 NA 9.68E-23 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 2.50E-07 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 3.86E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 1.34E-13 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 1.61E-07 1.61E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 1.42E-57 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 3.32E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 3.20E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 3.78E-06 3.78E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 1.67E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 1.81E-06 NA mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 1.02E-13 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 1.68E-08 1.68E-08 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 1.48E-07 1.48E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 9.32E-35 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 5.53E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 5.14E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 6.92E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 4.97E-06 6.93E-09 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 5.33E-20 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 6.47E-06 5.49E-09 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 3.11E-31 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 NA 4.72E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614300581 8.19E-06 8.19E-06 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251