\
| Variant ID: vg0614297874 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14297874 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGAATCGTGTCTTGTGGGTACAGTGGTACATCTCTGGCCAGAGTAAAACTATTCGAATAGCCGTGCCCGCGGTTATGGGCGGGTCTAACAATGTTTTTC[G/A,T]
TGATTAGTCCCACACTACTCATTAATGATAACAATGTGATAATTAATTTGACTCCTGGTTTAGAATGGATAATTCCTGGTTTGGAGGTTTGATCTGTACG
CGTACAGATCAAACCTCCAAACCAGGAATTATCCATTCTAAACCAGGAGTCAAATTAATTATCACATTGTTATCATTAATGAGTAGTGTGGGACTAATCA[C/T,A]
GAAAAACATTGTTAGACCCGCCCATAACCGCGGGCACGGCTATTCGAATAGTTTTACTCTGGCCAGAGATGTACCACTGTACCCACAAGACACGATTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 5.00% | 6.79% | 0.68% | NA |
| All Indica | 2759 | 98.70% | 0.30% | 1.01% | 0.04% | NA |
| All Japonica | 1512 | 64.90% | 14.60% | 18.45% | 1.98% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.20% | 1.08% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 0.90% | 2.42% | 0.13% | NA |
| Temperate Japonica | 767 | 95.30% | 1.40% | 3.26% | 0.00% | NA |
| Tropical Japonica | 504 | 24.00% | 29.60% | 40.67% | 5.75% | NA |
| Japonica Intermediate | 241 | 53.90% | 25.30% | 20.33% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 6.70% | 12.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614297874 | G -> T | LOC_Os06g24420.1 | upstream_gene_variant ; 4038.0bp to feature; MODIFIER | N | Average:60.814; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0614297874 | G -> T | LOC_Os06g24404-LOC_Os06g24420 | intergenic_region ; MODIFIER | N | Average:60.814; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0614297874 | G -> A | LOC_Os06g24420.1 | upstream_gene_variant ; 4038.0bp to feature; MODIFIER | silent_mutation | Average:60.814; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0614297874 | G -> A | LOC_Os06g24404-LOC_Os06g24420 | intergenic_region ; MODIFIER | silent_mutation | Average:60.814; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0614297874 | G -> DEL | N | N | silent_mutation | Average:60.814; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614297874 | NA | 8.27E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 5.43E-09 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 1.59E-20 | mr1593 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 6.85E-29 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 8.34E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 2.52E-17 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 1.49E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 3.98E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 1.41E-06 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 2.08E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 8.62E-13 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 8.94E-24 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 3.66E-31 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 1.40E-12 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614297874 | NA | 2.72E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |