\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614282747:

Variant ID: vg0614282747 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 14282747
Reference Allele: TAlternative Allele: C,TGGTA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACACGCCCTATGCAACACAATTAATTACACGCACCAAGCGACACAGTTAGTTTGCTCACCGTGGGCCATAATGGAATGAGCGATGCCGCATGCTAGCT[T/C,TGGTA]
GACGCGGCTTTGTTTGGATCCTCCGGGTTATTAAATAGCCCTCCGAAATCTTGCTATTTAGGAGTATTAAACGTAGATTACCGACAAAACCGATTCCATA

Reverse complement sequence

TATGGAATCGGTTTTGTCGGTAATCTACGTTTAATACTCCTAAATAGCAAGATTTCGGAGGGCTATTTAATAACCCGGAGGATCCAAACAAAGCCGCGTC[A/G,TACCA]
AGCTAGCATGCGGCATCGCTCATTCCATTATGGCCCACGGTGAGCAAACTAACTGTGTCGCTTGGTGCGTGTAATTAATTGTGTTGCATAGGGCGTGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 17.20% 1.65% 0.00% TGGTA: 0.02%
All Indica  2759 99.30% 0.50% 0.14% 0.00% NA
All Japonica  1512 44.00% 52.10% 3.97% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.40% 0.51% 0.00% NA
Temperate Japonica  767 8.90% 87.70% 3.39% 0.00% NA
Tropical Japonica  504 91.30% 4.40% 4.37% 0.00% NA
Japonica Intermediate  241 56.80% 38.20% 4.98% 0.00% NA
VI/Aromatic  96 85.40% 1.00% 12.50% 0.00% TGGTA: 1.04%
Intermediate  90 87.80% 10.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614282747 T -> C LOC_Os06g24390.1 downstream_gene_variant ; 3085.0bp to feature; MODIFIER silent_mutation Average:63.812; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0614282747 T -> C LOC_Os06g24404.1 intron_variant ; MODIFIER silent_mutation Average:63.812; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0614282747 T -> C LOC_Os06g24404.2 intron_variant ; MODIFIER silent_mutation Average:63.812; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0614282747 T -> TGGTA LOC_Os06g24390.1 downstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:63.812; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0614282747 T -> TGGTA LOC_Os06g24404.1 intron_variant ; MODIFIER silent_mutation Average:63.812; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0614282747 T -> TGGTA LOC_Os06g24404.2 intron_variant ; MODIFIER silent_mutation Average:63.812; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0614282747 T C -0.33 -0.07 -0.04 -0.01 -0.09 -0.08
vg0614282747 T TGGTA -0.59 0.13 0.02 -0.15 0.05 0.18

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614282747 NA 8.68E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 4.78E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 7.45E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 7.73E-13 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 2.41E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 3.13E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 9.71E-25 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 1.43E-06 NA mr1355_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 8.10E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 9.40E-06 NA mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 1.24E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 4.66E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 6.90E-21 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 2.14E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 6.00E-07 NA mr1712_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 7.49E-06 NA mr1712_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 6.13E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 7.88E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 3.15E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614282747 NA 7.42E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251