\
| Variant ID: vg0614236515 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14236515 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCGACAACAGCGTCAACACCGGCATCAACTAAGGAGTTTCTACTTCAACAATGCTAGTGTAGACTCAAGTCGGCGAAATTGTCTTCCCGGTTTACACCA[C/T]
GATGCCGATCTTGACTGATCCATCAATGACCGGAAGCGAGAACGCCGTGGTTACAACCCTGGGCGACTCCATGTCGAAGGATCCTCCCGCATAAGTGGAG
CTCCACTTATGCGGGAGGATCCTTCGACATGGAGTCGCCCAGGGTTGTAACCACGGCGTTCTCGCTTCCGGTCATTGATGGATCAGTCAAGATCGGCATC[G/A]
TGGTGTAAACCGGGAAGACAATTTCGCCGACTTGAGTCTACACTAGCATTGTTGAAGTAGAAACTCCTTAGTTGATGCCGGTGTTGACGCTGTTGTCGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 7.20% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 79.40% | 19.40% | 1.26% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 46.60% | 51.40% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 9.10% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614236515 | C -> T | LOC_Os06g24310-LOC_Os06g24350 | intergenic_region ; MODIFIER | silent_mutation | Average:45.029; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614236515 | NA | 1.02E-06 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | 1.08E-07 | 7.58E-26 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | NA | 1.17E-15 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | 2.93E-10 | 1.45E-22 | mr1410 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | NA | 9.94E-17 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | NA | 7.94E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | 3.92E-07 | 3.55E-25 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | NA | 4.78E-17 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | 3.45E-09 | 5.94E-22 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | NA | 4.86E-16 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | NA | 4.09E-11 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614236515 | NA | 1.13E-11 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |