Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614114702:

Variant ID: vg0614114702 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 14114702
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGATTCACTAGTGAGAAACAGTGTCTAGGGAAAGCTTAATTTTAATCCTAACGCAATACTTCAGGCACTGGCAACCCGCTATTCCCAAATATCGCTCTAC[T/G]
ACATACTCGGACAGGGATGACTTCAGTGATCTCGAGGGCTGTCACCACCTCTACACCCACCTCACGTACTGTGGGATACGCAGCAATTACTGAATAATAA

Reverse complement sequence

TTATTATTCAGTAATTGCTGCGTATCCCACAGTACGTGAGGTGGGTGTAGAGGTGGTGACAGCCCTCGAGATCACTGAAGTCATCCCTGTCCGAGTATGT[A/C]
GTAGAGCGATATTTGGGAATAGCGGGTTGCCAGTGCCTGAAGTATTGCGTTAGGATTAAAATTAAGCTTTCCCTAGACACTGTTTCTCACTAGTGAATCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	33.90%	2.16%	3.87%	NA
All Indica	2759	90.60%	2.70%	1.16%	5.51%	NA
All Japonica	1512	8.60%	90.90%	0.13%	0.33%	NA
Aus	269	57.20%	40.50%	0.37%	1.86%	NA
Indica I	595	92.60%	4.70%	0.67%	2.02%	NA
Indica II	465	91.80%	1.90%	0.86%	5.38%	NA
Indica III	913	89.70%	0.30%	1.31%	8.65%	NA
Indica Intermediate	786	89.40%	4.50%	1.53%	4.58%	NA
Temperate Japonica	767	3.30%	96.30%	0.13%	0.26%	NA
Tropical Japonica	504	17.30%	82.30%	0.00%	0.40%	NA
Japonica Intermediate	241	7.50%	91.70%	0.41%	0.41%	NA
VI/Aromatic	96	13.50%	5.20%	63.54%	17.71%	NA
Intermediate	90	44.40%	44.40%	6.67%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0614114702	T -> G	LOC_Os06g24110.1	upstream_gene_variant ; 2475.0bp to feature; MODIFIER	silent_mutation	Average:38.661; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg0614114702	T -> G	LOC_Os06g24120.1	upstream_gene_variant ; 1563.0bp to feature; MODIFIER	silent_mutation	Average:38.661; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg0614114702	T -> G	LOC_Os06g24130.1	downstream_gene_variant ; 1894.0bp to feature; MODIFIER	silent_mutation	Average:38.661; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg0614114702	T -> G	LOC_Os06g24120-LOC_Os06g24130	intergenic_region ; MODIFIER	silent_mutation	Average:38.661; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg0614114702	T -> DEL	N	N	silent_mutation	Average:38.661; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0614114702	NA	2.80E-06	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	3.22E-07	3.22E-07	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	4.52E-06	4.15E-12	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	6.33E-06	6.33E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	7.99E-06	5.97E-08	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	1.17E-07	1.17E-07	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	4.79E-07	4.79E-07	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	1.14E-06	NA	mr1719	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	3.07E-09	7.62E-10	mr1719	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	NA	1.28E-07	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	3.01E-07	6.20E-16	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	NA	4.61E-08	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614114702	6.67E-06	4.94E-09	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251