\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614110509:

Variant ID: vg0614110509 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14110509
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGCAGTTCGGCTTCAACATTGTGCACAGCCCTGTTGATTATGGCCAGATCGCCTTTTGACGCGGCCGAAGGCTGAAGCCCCTTGACCACTATCACTCC[C/T]
GCTGGGCCGGGCATTTTGAGCTTGAGATAGTTATGGTGGGAAATGGCTTCGAACTTGTTCAGGGTCGCACGGCCCAGGATGGCATTGTAGTTGTACGGGA

Reverse complement sequence

TCCCGTACAACTACAATGCCATCCTGGGCCGTGCGACCCTGAACAAGTTCGAAGCCATTTCCCACCATAACTATCTCAAGCTCAAAATGCCCGGCCCAGC[G/A]
GGAGTGATAGTGGTCAAGGGGCTTCAGCCTTCGGCCGCGTCAAAAGGCGATCTGGCCATAATCAACAGGGCTGTGCACAATGTTGAAGCCGAACTGCACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 32.20% 0.11% 0.00% NA
All Indica  2759 50.60% 49.30% 0.07% 0.00% NA
All Japonica  1512 98.40% 1.50% 0.13% 0.00% NA
Aus  269 60.20% 39.40% 0.37% 0.00% NA
Indica I  595 19.30% 80.50% 0.17% 0.00% NA
Indica II  465 28.20% 71.60% 0.22% 0.00% NA
Indica III  913 85.70% 14.30% 0.00% 0.00% NA
Indica Intermediate  786 46.80% 53.20% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 2.90% 0.83% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614110509 C -> T LOC_Os06g24100.1 downstream_gene_variant ; 3711.0bp to feature; MODIFIER silent_mutation Average:54.127; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0614110509 C -> T LOC_Os06g24120.1 downstream_gene_variant ; 2103.0bp to feature; MODIFIER silent_mutation Average:54.127; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0614110509 C -> T LOC_Os06g24110.1 intron_variant ; MODIFIER silent_mutation Average:54.127; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614110509 NA 9.06E-13 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 2.28E-12 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 2.36E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 7.94E-12 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 1.57E-12 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 4.14E-11 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 1.59E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 8.78E-11 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 1.42E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 2.78E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 5.18E-10 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 2.03E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 2.49E-06 3.95E-15 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 4.80E-14 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 9.54E-06 9.18E-10 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 2.45E-06 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 1.69E-08 5.89E-17 mr1087_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 2.92E-13 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 9.95E-15 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 5.93E-11 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 8.59E-15 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 6.66E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 6.32E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 1.96E-06 NA mr1526_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 5.47E-08 6.60E-13 mr1526_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 6.77E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 1.02E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 6.81E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 2.54E-23 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614110509 NA 3.20E-09 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251