\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0614105710:

Variant ID: vg0614105710 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 14105710
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCCTCCGCATCAGCCGGTTGCATCGCCGCTAATTGAGGCGAAGGGAAAGAGAGCGGTCGTCGAGACGTCCGCTTCGGAATATTCGCTCGTGGCACCC[C/T]
GTTTCGCCCCTGGTGATTTCGAGACTCGGGCGGACCTCCTTCCTTTTGTGGAGGGGGTAAGCAATCTTGTATTGCCTGCCAGTACCCCGAGCTTGTTCAC

Reverse complement sequence

GTGAACAAGCTCGGGGTACTGGCAGGCAATACAAGATTGCTTACCCCCTCCACAAAAGGAAGGAGGTCCGCCCGAGTCTCGAAATCACCAGGGGCGAAAC[G/A]
GGGTGCCACGAGCGAATATTCCGAAGCGGACGTCTCGACGACCGCTCTCTTTCCCTTCGCCTCAATTAGCGGCGATGCAACCGGCTGATGCGGAGGATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 28.50% 1.57% 2.35% NA
All Indica  2759 52.20% 43.70% 0.62% 3.41% NA
All Japonica  1512 98.70% 1.20% 0.07% 0.07% NA
Aus  269 59.90% 34.20% 0.37% 5.58% NA
Indica I  595 20.80% 75.30% 0.67% 3.19% NA
Indica II  465 30.80% 66.00% 0.65% 2.58% NA
Indica III  913 86.20% 10.40% 0.33% 3.07% NA
Indica Intermediate  786 49.20% 45.40% 0.89% 4.45% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 32.30% 10.40% 56.25% 1.04% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0614105710 C -> T LOC_Os06g24100.1 missense_variant ; p.Arg542Cys; MODERATE nonsynonymous_codon ; R542C Average:64.178; most accessible tissue: Zhenshan97 flag leaf, score: 85.259 probably damaging 3.123 DELETERIOUS 0.04
vg0614105710 C -> DEL LOC_Os06g24100.1 N frameshift_variant Average:64.178; most accessible tissue: Zhenshan97 flag leaf, score: 85.259 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0614105710 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0614105710 2.09E-06 NA mr1910_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614105710 1.39E-06 1.67E-06 mr1910_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0614105710 8.96E-06 NA mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251