\
| Variant ID: vg0614036364 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 14036364 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTATTATGCCGCCGTCGTTGGGCGTCTACGTCTTCACCGACCGGCTTGCCTTTGCCGCCGCCGACTAGTGTCTTCGCCTGCATGACTGGTCTATTATGC[C/T]
GTCGTTGTTGGGCGTCAACGCTTTCACCGACTGGCTTGCCTTCGCCACTGCCGACTGGTGTCTCCGCCTGCACGGCTGGCCTATTATGCCACCGTTGTTG
CAACAACGGTGGCATAATAGGCCAGCCGTGCAGGCGGAGACACCAGTCGGCAGTGGCGAAGGCAAGCCAGTCGGTGAAAGCGTTGACGCCCAACAACGAC[G/A]
GCATAATAGACCAGTCATGCAGGCGAAGACACTAGTCGGCGGCGGCAAAGGCAAGCCGGTCGGTGAAGACGTAGACGCCCAACGACGGCGGCATAATAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.80% | 4.50% | 4.72% | 42.95% | NA |
| All Indica | 2759 | 27.20% | 0.60% | 5.76% | 66.44% | NA |
| All Japonica | 1512 | 78.30% | 12.80% | 3.04% | 5.89% | NA |
| Aus | 269 | 65.40% | 0.00% | 3.35% | 31.23% | NA |
| Indica I | 595 | 35.00% | 0.00% | 2.52% | 62.52% | NA |
| Indica II | 465 | 45.60% | 0.90% | 4.09% | 49.46% | NA |
| Indica III | 913 | 9.70% | 0.10% | 8.32% | 81.82% | NA |
| Indica Intermediate | 786 | 30.80% | 1.40% | 6.23% | 61.58% | NA |
| Temperate Japonica | 767 | 96.00% | 1.20% | 0.91% | 1.96% | NA |
| Tropical Japonica | 504 | 46.00% | 34.70% | 7.34% | 11.90% | NA |
| Japonica Intermediate | 241 | 89.60% | 3.70% | 0.83% | 5.81% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 2.08% | 7.29% | NA |
| Intermediate | 90 | 66.70% | 6.70% | 7.78% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0614036364 | C -> T | LOC_Os06g24030.1 | missense_variant ; p.Pro2Leu; MODERATE | nonsynonymous_codon ; P2L | Average:31.6; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | unknown | unknown | DELETERIOUS | 0.03 |
| vg0614036364 | C -> DEL | LOC_Os06g24030.1 | N | frameshift_variant | Average:31.6; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0614036364 | 9.29E-06 | 3.65E-06 | mr1633 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614036364 | NA | 2.30E-07 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614036364 | 2.62E-06 | 5.07E-09 | mr1243_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614036364 | NA | 3.16E-08 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614036364 | NA | 1.09E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614036364 | NA | 9.75E-09 | mr1251_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614036364 | NA | 7.53E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614036364 | NA | 4.58E-07 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614036364 | NA | 8.75E-09 | mr1435_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0614036364 | NA | 1.26E-07 | mr1599_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |