\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613879682:

Variant ID: vg0613879682 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13879682
Reference Allele: CAlternative Allele: T,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATGCATATATATAGTTTTATACATTTCA[C/T,G]
AAAAGTTTTTAAATAAGACGAACGGTCAAACATGTTTAAAAAAATCAACGGCGTCAAATATTTAGGGAAGGAGGGAGTACTATATATCAAAGTTGTTGAG

Reverse complement sequence

CTCAACAACTTTGATATATAGTACTCCCTCCTTCCCTAAATATTTGACGCCGTTGATTTTTTTAAACATGTTTGACCGTTCGTCTTATTTAAAAACTTTT[G/A,C]
TGAAATGTATAAAACTATATATATGCATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTAAATAAGACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 34.20% 1.25% 0.72% G: 0.61%
All Indica  2759 96.20% 2.60% 0.22% 0.00% G: 1.05%
All Japonica  1512 8.90% 90.90% 0.13% 0.07% NA
Aus  269 53.20% 46.80% 0.00% 0.00% NA
Indica I  595 93.30% 2.90% 0.17% 0.00% G: 3.70%
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.30% 0.40% 0.22% 0.00% NA
Indica Intermediate  786 93.10% 5.60% 0.38% 0.00% G: 0.89%
Temperate Japonica  767 3.50% 96.30% 0.13% 0.00% NA
Tropical Japonica  504 17.90% 82.10% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 91.70% 0.41% 0.41% NA
VI/Aromatic  96 14.60% 5.20% 47.92% 32.29% NA
Intermediate  90 50.00% 42.20% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613879682 C -> G LOC_Os06g23760.1 upstream_gene_variant ; 3568.0bp to feature; MODIFIER silent_mutation Average:31.239; most accessible tissue: Callus, score: 63.891 N N N N
vg0613879682 C -> G LOC_Os06g23750.1 downstream_gene_variant ; 1494.0bp to feature; MODIFIER silent_mutation Average:31.239; most accessible tissue: Callus, score: 63.891 N N N N
vg0613879682 C -> G LOC_Os06g23750-LOC_Os06g23760 intergenic_region ; MODIFIER silent_mutation Average:31.239; most accessible tissue: Callus, score: 63.891 N N N N
vg0613879682 C -> T LOC_Os06g23760.1 upstream_gene_variant ; 3568.0bp to feature; MODIFIER silent_mutation Average:31.239; most accessible tissue: Callus, score: 63.891 N N N N
vg0613879682 C -> T LOC_Os06g23750.1 downstream_gene_variant ; 1494.0bp to feature; MODIFIER silent_mutation Average:31.239; most accessible tissue: Callus, score: 63.891 N N N N
vg0613879682 C -> T LOC_Os06g23750-LOC_Os06g23760 intergenic_region ; MODIFIER silent_mutation Average:31.239; most accessible tissue: Callus, score: 63.891 N N N N
vg0613879682 C -> DEL N N silent_mutation Average:31.239; most accessible tissue: Callus, score: 63.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613879682 NA 3.32E-13 mr1175 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613879682 NA 7.62E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613879682 NA 1.84E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613879682 NA 1.58E-35 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613879682 NA 2.37E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251