\
| Variant ID: vg0613879682 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13879682 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATGCATATATATAGTTTTATACATTTCA[C/T,G]
AAAAGTTTTTAAATAAGACGAACGGTCAAACATGTTTAAAAAAATCAACGGCGTCAAATATTTAGGGAAGGAGGGAGTACTATATATCAAAGTTGTTGAG
CTCAACAACTTTGATATATAGTACTCCCTCCTTCCCTAAATATTTGACGCCGTTGATTTTTTTAAACATGTTTGACCGTTCGTCTTATTTAAAAACTTTT[G/A,C]
TGAAATGTATAAAACTATATATATGCATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTAAATAAGACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 34.20% | 1.25% | 0.72% | G: 0.61% |
| All Indica | 2759 | 96.20% | 2.60% | 0.22% | 0.00% | G: 1.05% |
| All Japonica | 1512 | 8.90% | 90.90% | 0.13% | 0.07% | NA |
| Aus | 269 | 53.20% | 46.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.30% | 2.90% | 0.17% | 0.00% | G: 3.70% |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 5.60% | 0.38% | 0.00% | G: 0.89% |
| Temperate Japonica | 767 | 3.50% | 96.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 17.90% | 82.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 91.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 14.60% | 5.20% | 47.92% | 32.29% | NA |
| Intermediate | 90 | 50.00% | 42.20% | 5.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613879682 | C -> G | LOC_Os06g23760.1 | upstream_gene_variant ; 3568.0bp to feature; MODIFIER | silent_mutation | Average:31.239; most accessible tissue: Callus, score: 63.891 | N | N | N | N |
| vg0613879682 | C -> G | LOC_Os06g23750.1 | downstream_gene_variant ; 1494.0bp to feature; MODIFIER | silent_mutation | Average:31.239; most accessible tissue: Callus, score: 63.891 | N | N | N | N |
| vg0613879682 | C -> G | LOC_Os06g23750-LOC_Os06g23760 | intergenic_region ; MODIFIER | silent_mutation | Average:31.239; most accessible tissue: Callus, score: 63.891 | N | N | N | N |
| vg0613879682 | C -> T | LOC_Os06g23760.1 | upstream_gene_variant ; 3568.0bp to feature; MODIFIER | silent_mutation | Average:31.239; most accessible tissue: Callus, score: 63.891 | N | N | N | N |
| vg0613879682 | C -> T | LOC_Os06g23750.1 | downstream_gene_variant ; 1494.0bp to feature; MODIFIER | silent_mutation | Average:31.239; most accessible tissue: Callus, score: 63.891 | N | N | N | N |
| vg0613879682 | C -> T | LOC_Os06g23750-LOC_Os06g23760 | intergenic_region ; MODIFIER | silent_mutation | Average:31.239; most accessible tissue: Callus, score: 63.891 | N | N | N | N |
| vg0613879682 | C -> DEL | N | N | silent_mutation | Average:31.239; most accessible tissue: Callus, score: 63.891 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613879682 | NA | 3.32E-13 | mr1175 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613879682 | NA | 7.62E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613879682 | NA | 1.84E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613879682 | NA | 1.58E-35 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613879682 | NA | 2.37E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |