Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613879682:

Variant ID: vg0613879682 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13879682
Reference Allele: C	Alternative Allele: T,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATGCATATATATAGTTTTATACATTTCA[C/T,G]
AAAAGTTTTTAAATAAGACGAACGGTCAAACATGTTTAAAAAAATCAACGGCGTCAAATATTTAGGGAAGGAGGGAGTACTATATATCAAAGTTGTTGAG

Reverse complement sequence

CTCAACAACTTTGATATATAGTACTCCCTCCTTCCCTAAATATTTGACGCCGTTGATTTTTTTAAACATGTTTGACCGTTCGTCTTATTTAAAAACTTTT[G/A,C]
TGAAATGTATAAAACTATATATATGCATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTAAATAAGACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.30%	34.20%	1.25%	0.72%	G: 0.61%
All Indica	2759	96.20%	2.60%	0.22%	0.00%	G: 1.05%
All Japonica	1512	8.90%	90.90%	0.13%	0.07%	NA
Aus	269	53.20%	46.80%	0.00%	0.00%	NA
Indica I	595	93.30%	2.90%	0.17%	0.00%	G: 3.70%
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.30%	0.40%	0.22%	0.00%	NA
Indica Intermediate	786	93.10%	5.60%	0.38%	0.00%	G: 0.89%
Temperate Japonica	767	3.50%	96.30%	0.13%	0.00%	NA
Tropical Japonica	504	17.90%	82.10%	0.00%	0.00%	NA
Japonica Intermediate	241	7.50%	91.70%	0.41%	0.41%	NA
VI/Aromatic	96	14.60%	5.20%	47.92%	32.29%	NA
Intermediate	90	50.00%	42.20%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613879682	C -> G	LOC_Os06g23760.1	upstream_gene_variant ; 3568.0bp to feature; MODIFIER	silent_mutation	Average:31.239; most accessible tissue: Callus, score: 63.891	N	N	N	N
vg0613879682	C -> G	LOC_Os06g23750.1	downstream_gene_variant ; 1494.0bp to feature; MODIFIER	silent_mutation	Average:31.239; most accessible tissue: Callus, score: 63.891	N	N	N	N
vg0613879682	C -> G	LOC_Os06g23750-LOC_Os06g23760	intergenic_region ; MODIFIER	silent_mutation	Average:31.239; most accessible tissue: Callus, score: 63.891	N	N	N	N
vg0613879682	C -> T	LOC_Os06g23760.1	upstream_gene_variant ; 3568.0bp to feature; MODIFIER	silent_mutation	Average:31.239; most accessible tissue: Callus, score: 63.891	N	N	N	N
vg0613879682	C -> T	LOC_Os06g23750.1	downstream_gene_variant ; 1494.0bp to feature; MODIFIER	silent_mutation	Average:31.239; most accessible tissue: Callus, score: 63.891	N	N	N	N
vg0613879682	C -> T	LOC_Os06g23750-LOC_Os06g23760	intergenic_region ; MODIFIER	silent_mutation	Average:31.239; most accessible tissue: Callus, score: 63.891	N	N	N	N
vg0613879682	C -> DEL	N	N	silent_mutation	Average:31.239; most accessible tissue: Callus, score: 63.891	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613879682	NA	3.32E-13	mr1175	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613879682	NA	7.62E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613879682	NA	1.84E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613879682	NA	1.58E-35	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613879682	NA	2.37E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251