\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613877367:

Variant ID: vg0613877367 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13877367
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GCCACTAGTTTTTTACAGGTGGCCCTACAAGAATAGTGCCTGAGAAAATGGTTGAGGCTGTCCTATAGCATCTCCAACAGACTATCTAAAATAGACTCTC[T/C,G]
AAATACCTATATAGCCAACTACCCAATTGATTTGGCAAGCCAAACTCATTGCTCACTCCAACAAAATCTCTATCTACACTCTCCATTCTGAGTCTATTAC

Reverse complement sequence

GTAATAGACTCAGAATGGAGAGTGTAGATAGAGATTTTGTTGGAGTGAGCAATGAGTTTGGCTTGCCAAATCAATTGGGTAGTTGGCTATATAGGTATTT[A/G,C]
GAGAGTCTATTTTAGATAGTCTGTTGGAGATGCTATAGGACAGCCTCAACCATTTTCTCAGGCACTATTCTTGTAGGGCCACCTGTAAAAAACTAGTGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.70% 14.50% 6.92% 45.83% G: 0.02%
All Indica  2759 4.50% 12.40% 10.91% 72.16% NA
All Japonica  1512 91.10% 6.60% 0.07% 2.12% G: 0.07%
Aus  269 2.60% 52.40% 7.06% 37.92% NA
Indica I  595 6.10% 8.40% 11.60% 73.95% NA
Indica II  465 3.90% 13.30% 12.47% 70.32% NA
Indica III  913 1.40% 16.30% 9.42% 72.84% NA
Indica Intermediate  786 7.30% 10.40% 11.20% 71.12% NA
Temperate Japonica  767 96.90% 0.40% 0.13% 2.61% NA
Tropical Japonica  504 82.10% 16.30% 0.00% 1.39% G: 0.20%
Japonica Intermediate  241 91.70% 6.20% 0.00% 2.07% NA
VI/Aromatic  96 2.10% 86.50% 2.08% 9.38% NA
Intermediate  90 38.90% 21.10% 4.44% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613877367 T -> C LOC_Os06g23750.1 upstream_gene_variant ; 255.0bp to feature; MODIFIER silent_mutation Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 N N N N
vg0613877367 T -> C LOC_Os06g23740.1 downstream_gene_variant ; 3944.0bp to feature; MODIFIER silent_mutation Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 N N N N
vg0613877367 T -> C LOC_Os06g23740-LOC_Os06g23750 intergenic_region ; MODIFIER silent_mutation Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 N N N N
vg0613877367 T -> G LOC_Os06g23750.1 upstream_gene_variant ; 255.0bp to feature; MODIFIER silent_mutation Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 N N N N
vg0613877367 T -> G LOC_Os06g23740.1 downstream_gene_variant ; 3944.0bp to feature; MODIFIER silent_mutation Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 N N N N
vg0613877367 T -> G LOC_Os06g23740-LOC_Os06g23750 intergenic_region ; MODIFIER silent_mutation Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 N N N N
vg0613877367 T -> DEL N N silent_mutation Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613877367 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 3.22E-07 3.22E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 4.52E-06 4.15E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 6.33E-06 6.33E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 7.99E-06 5.97E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 NA 1.63E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 4.97E-06 4.97E-06 mr1392 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 1.17E-07 1.17E-07 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 4.79E-07 4.79E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 NA 7.71E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 NA 1.28E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 3.01E-07 6.20E-16 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 6.67E-06 4.94E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367 NA 5.48E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251