Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613877367:

Variant ID: vg0613877367 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13877367
Reference Allele: T	Alternative Allele: C,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GCCACTAGTTTTTTACAGGTGGCCCTACAAGAATAGTGCCTGAGAAAATGGTTGAGGCTGTCCTATAGCATCTCCAACAGACTATCTAAAATAGACTCTC[T/C,G]
AAATACCTATATAGCCAACTACCCAATTGATTTGGCAAGCCAAACTCATTGCTCACTCCAACAAAATCTCTATCTACACTCTCCATTCTGAGTCTATTAC

Reverse complement sequence

GTAATAGACTCAGAATGGAGAGTGTAGATAGAGATTTTGTTGGAGTGAGCAATGAGTTTGGCTTGCCAAATCAATTGGGTAGTTGGCTATATAGGTATTT[A/G,C]
GAGAGTCTATTTTAGATAGTCTGTTGGAGATGCTATAGGACAGCCTCAACCATTTTCTCAGGCACTATTCTTGTAGGGCCACCTGTAAAAAACTAGTGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.70%	14.50%	6.92%	45.83%	G: 0.02%
All Indica	2759	4.50%	12.40%	10.91%	72.16%	NA
All Japonica	1512	91.10%	6.60%	0.07%	2.12%	G: 0.07%
Aus	269	2.60%	52.40%	7.06%	37.92%	NA
Indica I	595	6.10%	8.40%	11.60%	73.95%	NA
Indica II	465	3.90%	13.30%	12.47%	70.32%	NA
Indica III	913	1.40%	16.30%	9.42%	72.84%	NA
Indica Intermediate	786	7.30%	10.40%	11.20%	71.12%	NA
Temperate Japonica	767	96.90%	0.40%	0.13%	2.61%	NA
Tropical Japonica	504	82.10%	16.30%	0.00%	1.39%	G: 0.20%
Japonica Intermediate	241	91.70%	6.20%	0.00%	2.07%	NA
VI/Aromatic	96	2.10%	86.50%	2.08%	9.38%	NA
Intermediate	90	38.90%	21.10%	4.44%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613877367	T -> C	LOC_Os06g23750.1	upstream_gene_variant ; 255.0bp to feature; MODIFIER	silent_mutation	Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481	N	N	N	N
vg0613877367	T -> C	LOC_Os06g23740.1	downstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481	N	N	N	N
vg0613877367	T -> C	LOC_Os06g23740-LOC_Os06g23750	intergenic_region ; MODIFIER	silent_mutation	Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481	N	N	N	N
vg0613877367	T -> G	LOC_Os06g23750.1	upstream_gene_variant ; 255.0bp to feature; MODIFIER	silent_mutation	Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481	N	N	N	N
vg0613877367	T -> G	LOC_Os06g23740.1	downstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481	N	N	N	N
vg0613877367	T -> G	LOC_Os06g23740-LOC_Os06g23750	intergenic_region ; MODIFIER	silent_mutation	Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481	N	N	N	N
vg0613877367	T -> DEL	N	N	silent_mutation	Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613877367	NA	2.80E-06	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	3.22E-07	3.22E-07	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	4.52E-06	4.15E-12	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	6.33E-06	6.33E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	7.99E-06	5.97E-08	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	NA	1.63E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	4.97E-06	4.97E-06	mr1392	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	1.17E-07	1.17E-07	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	4.79E-07	4.79E-07	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	NA	7.71E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	NA	1.28E-07	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	3.01E-07	6.20E-16	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	6.67E-06	4.94E-09	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613877367	NA	5.48E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251