\
| Variant ID: vg0613877367 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13877367 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 109. )
GCCACTAGTTTTTTACAGGTGGCCCTACAAGAATAGTGCCTGAGAAAATGGTTGAGGCTGTCCTATAGCATCTCCAACAGACTATCTAAAATAGACTCTC[T/C,G]
AAATACCTATATAGCCAACTACCCAATTGATTTGGCAAGCCAAACTCATTGCTCACTCCAACAAAATCTCTATCTACACTCTCCATTCTGAGTCTATTAC
GTAATAGACTCAGAATGGAGAGTGTAGATAGAGATTTTGTTGGAGTGAGCAATGAGTTTGGCTTGCCAAATCAATTGGGTAGTTGGCTATATAGGTATTT[A/G,C]
GAGAGTCTATTTTAGATAGTCTGTTGGAGATGCTATAGGACAGCCTCAACCATTTTCTCAGGCACTATTCTTGTAGGGCCACCTGTAAAAAACTAGTGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 14.50% | 6.92% | 45.83% | G: 0.02% |
| All Indica | 2759 | 4.50% | 12.40% | 10.91% | 72.16% | NA |
| All Japonica | 1512 | 91.10% | 6.60% | 0.07% | 2.12% | G: 0.07% |
| Aus | 269 | 2.60% | 52.40% | 7.06% | 37.92% | NA |
| Indica I | 595 | 6.10% | 8.40% | 11.60% | 73.95% | NA |
| Indica II | 465 | 3.90% | 13.30% | 12.47% | 70.32% | NA |
| Indica III | 913 | 1.40% | 16.30% | 9.42% | 72.84% | NA |
| Indica Intermediate | 786 | 7.30% | 10.40% | 11.20% | 71.12% | NA |
| Temperate Japonica | 767 | 96.90% | 0.40% | 0.13% | 2.61% | NA |
| Tropical Japonica | 504 | 82.10% | 16.30% | 0.00% | 1.39% | G: 0.20% |
| Japonica Intermediate | 241 | 91.70% | 6.20% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 2.10% | 86.50% | 2.08% | 9.38% | NA |
| Intermediate | 90 | 38.90% | 21.10% | 4.44% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613877367 | T -> C | LOC_Os06g23750.1 | upstream_gene_variant ; 255.0bp to feature; MODIFIER | silent_mutation | Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 | N | N | N | N |
| vg0613877367 | T -> C | LOC_Os06g23740.1 | downstream_gene_variant ; 3944.0bp to feature; MODIFIER | silent_mutation | Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 | N | N | N | N |
| vg0613877367 | T -> C | LOC_Os06g23740-LOC_Os06g23750 | intergenic_region ; MODIFIER | silent_mutation | Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 | N | N | N | N |
| vg0613877367 | T -> G | LOC_Os06g23750.1 | upstream_gene_variant ; 255.0bp to feature; MODIFIER | silent_mutation | Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 | N | N | N | N |
| vg0613877367 | T -> G | LOC_Os06g23740.1 | downstream_gene_variant ; 3944.0bp to feature; MODIFIER | silent_mutation | Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 | N | N | N | N |
| vg0613877367 | T -> G | LOC_Os06g23740-LOC_Os06g23750 | intergenic_region ; MODIFIER | silent_mutation | Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 | N | N | N | N |
| vg0613877367 | T -> DEL | N | N | silent_mutation | Average:37.497; most accessible tissue: Zhenshan97 flower, score: 82.481 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613877367 | NA | 2.80E-06 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | 3.22E-07 | 3.22E-07 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | 4.52E-06 | 4.15E-12 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | 6.33E-06 | 6.33E-06 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | 7.99E-06 | 5.97E-08 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | NA | 1.63E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | 4.97E-06 | 4.97E-06 | mr1392 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | 1.17E-07 | 1.17E-07 | mr1478 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | 4.79E-07 | 4.79E-07 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | NA | 7.71E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | NA | 1.28E-07 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | 3.01E-07 | 6.20E-16 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | 6.67E-06 | 4.94E-09 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613877367 | NA | 5.48E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |