\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613864390:

Variant ID: vg0613864390 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13864390
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCTCACAGCTGAAGTCGTCGAGTAGCTTGTTGTCGGAGGATCCATCTTTTGAACCCATCTCGTCGAAATCCTGAAGCACCAAAATCCCCCTACCTGGC[A/G]
CTCCACTGTCGACGTTTGATCTCTTGACTATGGTATTTGGACAGTATGGGGATCGTTGGTGCTAGGATATATGTGAGACTGAGGTAAAAGAGATGGAGAC

Reverse complement sequence

GTCTCCATCTCTTTTACCTCAGTCTCACATATATCCTAGCACCAACGATCCCCATACTGTCCAAATACCATAGTCAAGAGATCAAACGTCGACAGTGGAG[T/C]
GCCAGGTAGGGGGATTTTGGTGCTTCAGGATTTCGACGAGATGGGTTCAAAAGATGGATCCTCCGACAACAAGCTACTCGACGACTTCAGCTGTGAGGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 9.10% 4.36% 49.32% NA
All Indica  2759 11.30% 7.20% 6.85% 74.59% NA
All Japonica  1512 91.60% 6.20% 0.33% 1.92% NA
Aus  269 4.10% 45.70% 1.49% 48.70% NA
Indica I  595 18.00% 12.80% 6.72% 62.52% NA
Indica II  465 13.30% 2.80% 7.74% 76.13% NA
Indica III  913 3.70% 5.10% 5.37% 85.76% NA
Indica Intermediate  786 13.90% 8.10% 8.14% 69.85% NA
Temperate Japonica  767 97.00% 0.10% 0.52% 2.35% NA
Tropical Japonica  504 83.10% 15.70% 0.20% 0.99% NA
Japonica Intermediate  241 92.10% 5.40% 0.00% 2.49% NA
VI/Aromatic  96 5.20% 4.20% 0.00% 90.62% NA
Intermediate  90 48.90% 13.30% 8.89% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613864390 A -> G LOC_Os06g23710.1 upstream_gene_variant ; 3751.0bp to feature; MODIFIER silent_mutation Average:8.734; most accessible tissue: Callus, score: 32.036 N N N N
vg0613864390 A -> G LOC_Os06g23730.1 downstream_gene_variant ; 1464.0bp to feature; MODIFIER silent_mutation Average:8.734; most accessible tissue: Callus, score: 32.036 N N N N
vg0613864390 A -> G LOC_Os06g23720.1 intron_variant ; MODIFIER silent_mutation Average:8.734; most accessible tissue: Callus, score: 32.036 N N N N
vg0613864390 A -> DEL N N silent_mutation Average:8.734; most accessible tissue: Callus, score: 32.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613864390 NA 3.18E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390 NA 5.34E-07 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390 NA 1.23E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390 NA 6.68E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390 4.56E-06 3.11E-08 mr1574_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390 NA 1.03E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390 NA 1.44E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251