Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613864390:

Variant ID: vg0613864390 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13864390
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCTCACAGCTGAAGTCGTCGAGTAGCTTGTTGTCGGAGGATCCATCTTTTGAACCCATCTCGTCGAAATCCTGAAGCACCAAAATCCCCCTACCTGGC[A/G]
CTCCACTGTCGACGTTTGATCTCTTGACTATGGTATTTGGACAGTATGGGGATCGTTGGTGCTAGGATATATGTGAGACTGAGGTAAAAGAGATGGAGAC

Reverse complement sequence

GTCTCCATCTCTTTTACCTCAGTCTCACATATATCCTAGCACCAACGATCCCCATACTGTCCAAATACCATAGTCAAGAGATCAAACGTCGACAGTGGAG[T/C]
GCCAGGTAGGGGGATTTTGGTGCTTCAGGATTTCGACGAGATGGGTTCAAAAGATGGATCCTCCGACAACAAGCTACTCGACGACTTCAGCTGTGAGGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.20%	9.10%	4.36%	49.32%	NA
All Indica	2759	11.30%	7.20%	6.85%	74.59%	NA
All Japonica	1512	91.60%	6.20%	0.33%	1.92%	NA
Aus	269	4.10%	45.70%	1.49%	48.70%	NA
Indica I	595	18.00%	12.80%	6.72%	62.52%	NA
Indica II	465	13.30%	2.80%	7.74%	76.13%	NA
Indica III	913	3.70%	5.10%	5.37%	85.76%	NA
Indica Intermediate	786	13.90%	8.10%	8.14%	69.85%	NA
Temperate Japonica	767	97.00%	0.10%	0.52%	2.35%	NA
Tropical Japonica	504	83.10%	15.70%	0.20%	0.99%	NA
Japonica Intermediate	241	92.10%	5.40%	0.00%	2.49%	NA
VI/Aromatic	96	5.20%	4.20%	0.00%	90.62%	NA
Intermediate	90	48.90%	13.30%	8.89%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613864390	A -> G	LOC_Os06g23710.1	upstream_gene_variant ; 3751.0bp to feature; MODIFIER	silent_mutation	Average:8.734; most accessible tissue: Callus, score: 32.036	N	N	N	N
vg0613864390	A -> G	LOC_Os06g23730.1	downstream_gene_variant ; 1464.0bp to feature; MODIFIER	silent_mutation	Average:8.734; most accessible tissue: Callus, score: 32.036	N	N	N	N
vg0613864390	A -> G	LOC_Os06g23720.1	intron_variant ; MODIFIER	silent_mutation	Average:8.734; most accessible tissue: Callus, score: 32.036	N	N	N	N
vg0613864390	A -> DEL	N	N	silent_mutation	Average:8.734; most accessible tissue: Callus, score: 32.036	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613864390	NA	3.18E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390	NA	5.34E-07	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390	NA	1.23E-06	mr1952	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390	NA	6.68E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390	4.56E-06	3.11E-08	mr1574_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390	NA	1.03E-06	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613864390	NA	1.44E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251