\
| Variant ID: vg0613864390 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13864390 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 93. )
CTCCTCACAGCTGAAGTCGTCGAGTAGCTTGTTGTCGGAGGATCCATCTTTTGAACCCATCTCGTCGAAATCCTGAAGCACCAAAATCCCCCTACCTGGC[A/G]
CTCCACTGTCGACGTTTGATCTCTTGACTATGGTATTTGGACAGTATGGGGATCGTTGGTGCTAGGATATATGTGAGACTGAGGTAAAAGAGATGGAGAC
GTCTCCATCTCTTTTACCTCAGTCTCACATATATCCTAGCACCAACGATCCCCATACTGTCCAAATACCATAGTCAAGAGATCAAACGTCGACAGTGGAG[T/C]
GCCAGGTAGGGGGATTTTGGTGCTTCAGGATTTCGACGAGATGGGTTCAAAAGATGGATCCTCCGACAACAAGCTACTCGACGACTTCAGCTGTGAGGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.20% | 9.10% | 4.36% | 49.32% | NA |
| All Indica | 2759 | 11.30% | 7.20% | 6.85% | 74.59% | NA |
| All Japonica | 1512 | 91.60% | 6.20% | 0.33% | 1.92% | NA |
| Aus | 269 | 4.10% | 45.70% | 1.49% | 48.70% | NA |
| Indica I | 595 | 18.00% | 12.80% | 6.72% | 62.52% | NA |
| Indica II | 465 | 13.30% | 2.80% | 7.74% | 76.13% | NA |
| Indica III | 913 | 3.70% | 5.10% | 5.37% | 85.76% | NA |
| Indica Intermediate | 786 | 13.90% | 8.10% | 8.14% | 69.85% | NA |
| Temperate Japonica | 767 | 97.00% | 0.10% | 0.52% | 2.35% | NA |
| Tropical Japonica | 504 | 83.10% | 15.70% | 0.20% | 0.99% | NA |
| Japonica Intermediate | 241 | 92.10% | 5.40% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 5.20% | 4.20% | 0.00% | 90.62% | NA |
| Intermediate | 90 | 48.90% | 13.30% | 8.89% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613864390 | A -> G | LOC_Os06g23710.1 | upstream_gene_variant ; 3751.0bp to feature; MODIFIER | silent_mutation | Average:8.734; most accessible tissue: Callus, score: 32.036 | N | N | N | N |
| vg0613864390 | A -> G | LOC_Os06g23730.1 | downstream_gene_variant ; 1464.0bp to feature; MODIFIER | silent_mutation | Average:8.734; most accessible tissue: Callus, score: 32.036 | N | N | N | N |
| vg0613864390 | A -> G | LOC_Os06g23720.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.734; most accessible tissue: Callus, score: 32.036 | N | N | N | N |
| vg0613864390 | A -> DEL | N | N | silent_mutation | Average:8.734; most accessible tissue: Callus, score: 32.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613864390 | NA | 3.18E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613864390 | NA | 5.34E-07 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613864390 | NA | 1.23E-06 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613864390 | NA | 6.68E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613864390 | 4.56E-06 | 3.11E-08 | mr1574_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613864390 | NA | 1.03E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613864390 | NA | 1.44E-07 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |