\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613854532:

Variant ID: vg0613854532 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13854532
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAAAATGTAGTATAAACCTACAAACTACAGTAAAATACACAAATAGACGTCTGAGATTTGTATACATTATCGTGAGTAAATTTTTGCCGCAACAACTCA[C/T]
GTGCAATCCATAGCAATAACTTAGACTCAGATTAGCAAATGCAGCTTATTTACCTCATGTTCCCAGATAATTGTTGGCTACTTATATTTAATTTTTGAGA

Reverse complement sequence

TCTCAAAAATTAAATATAAGTAGCCAACAATTATCTGGGAACATGAGGTAAATAAGCTGCATTTGCTAATCTGAGTCTAAGTTATTGCTATGGATTGCAC[G/A]
TGAGTTGTTGCGGCAAAAATTTACTCACGATAATGTATACAAATCTCAGACGTCTATTTGTGTATTTTACTGTAGTTTGTAGGTTTATACTACATTTTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 39.20% 0.23% 0.00% NA
All Indica  2759 95.30% 4.40% 0.33% 0.00% NA
All Japonica  1512 2.50% 97.40% 0.07% 0.00% NA
Aus  269 52.80% 47.20% 0.00% 0.00% NA
Indica I  595 92.30% 7.40% 0.34% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 98.70% 1.10% 0.22% 0.00% NA
Indica Intermediate  786 93.00% 6.50% 0.51% 0.00% NA
Temperate Japonica  767 3.10% 96.70% 0.13% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 44.40% 54.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613854532 C -> T LOC_Os06g23710.1 downstream_gene_variant ; 353.0bp to feature; MODIFIER silent_mutation Average:25.988; most accessible tissue: Callus, score: 64.32 N N N N
vg0613854532 C -> T LOC_Os06g23684-LOC_Os06g23710 intergenic_region ; MODIFIER silent_mutation Average:25.988; most accessible tissue: Callus, score: 64.32 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613854532 NA 8.41E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 NA 1.79E-37 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 NA 5.71E-43 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 8.46E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 1.43E-06 2.03E-51 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 1.41E-07 7.63E-62 mr1087 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 1.84E-06 3.56E-53 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 3.03E-07 5.39E-43 mr1144 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 3.40E-07 9.47E-55 mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 NA 7.94E-42 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 NA 5.17E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 NA 5.23E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 NA 6.19E-63 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 NA 1.13E-73 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 3.38E-07 1.32E-61 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532 NA 5.91E-08 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251