Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613854532:

Variant ID: vg0613854532 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13854532
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAAATGTAGTATAAACCTACAAACTACAGTAAAATACACAAATAGACGTCTGAGATTTGTATACATTATCGTGAGTAAATTTTTGCCGCAACAACTCA[C/T]
GTGCAATCCATAGCAATAACTTAGACTCAGATTAGCAAATGCAGCTTATTTACCTCATGTTCCCAGATAATTGTTGGCTACTTATATTTAATTTTTGAGA

Reverse complement sequence

TCTCAAAAATTAAATATAAGTAGCCAACAATTATCTGGGAACATGAGGTAAATAAGCTGCATTTGCTAATCTGAGTCTAAGTTATTGCTATGGATTGCAC[G/A]
TGAGTTGTTGCGGCAAAAATTTACTCACGATAATGTATACAAATCTCAGACGTCTATTTGTGTATTTTACTGTAGTTTGTAGGTTTATACTACATTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	39.20%	0.23%	0.00%	NA
All Indica	2759	95.30%	4.40%	0.33%	0.00%	NA
All Japonica	1512	2.50%	97.40%	0.07%	0.00%	NA
Aus	269	52.80%	47.20%	0.00%	0.00%	NA
Indica I	595	92.30%	7.40%	0.34%	0.00%	NA
Indica II	465	96.10%	3.70%	0.22%	0.00%	NA
Indica III	913	98.70%	1.10%	0.22%	0.00%	NA
Indica Intermediate	786	93.00%	6.50%	0.51%	0.00%	NA
Temperate Japonica	767	3.10%	96.70%	0.13%	0.00%	NA
Tropical Japonica	504	1.80%	98.20%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	44.40%	54.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613854532	C -> T	LOC_Os06g23710.1	downstream_gene_variant ; 353.0bp to feature; MODIFIER	silent_mutation	Average:25.988; most accessible tissue: Callus, score: 64.32	N	N	N	N
vg0613854532	C -> T	LOC_Os06g23684-LOC_Os06g23710	intergenic_region ; MODIFIER	silent_mutation	Average:25.988; most accessible tissue: Callus, score: 64.32	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613854532	NA	8.41E-22	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	NA	1.79E-37	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	NA	5.71E-43	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	8.46E-06	NA	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	1.43E-06	2.03E-51	mr1078	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	1.41E-07	7.63E-62	mr1087	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	1.84E-06	3.56E-53	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	3.03E-07	5.39E-43	mr1144	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	3.40E-07	9.47E-55	mr1211	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	NA	7.94E-42	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	NA	5.17E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	NA	5.23E-21	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	NA	6.19E-63	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	NA	1.13E-73	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	3.38E-07	1.32E-61	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613854532	NA	5.91E-08	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251