\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613770354:

Variant ID: vg0613770354 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13770354
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTAGGTCACCTCTGACGGGCCTTTATTTGCTAGTCCGTCACAGATGATGTTACCTTTGACGGATTTTTGTTCCGACCCGTCACTGATGAGTTAATTCCA[A/G]
AAAAAAAAATAAATGCTAAATATTGGCTAGCCTCAGGATTTGCTAGTCATGCCCTCTGAAACACAGATAAATCACAGATATATTCCAGTCACCCCCCAAT

Reverse complement sequence

ATTGGGGGGTGACTGGAATATATCTGTGATTTATCTGTGTTTCAGAGGGCATGACTAGCAAATCCTGAGGCTAGCCAATATTTAGCATTTATTTTTTTTT[T/C]
TGGAATTAACTCATCAGTGACGGGTCGGAACAAAAATCCGTCAAAGGTAACATCATCTGTGACGGACTAGCAAATAAAGGCCCGTCAGAGGTGACCTACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 17.00% 3.30% 0.04% NA
All Indica  2759 98.90% 0.90% 0.22% 0.00% NA
All Japonica  1512 39.80% 50.40% 9.66% 0.13% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 97.30% 2.50% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 0.90% 0.64% 0.00% NA
Temperate Japonica  767 9.60% 84.60% 5.61% 0.13% NA
Tropical Japonica  504 86.90% 5.80% 7.34% 0.00% NA
Japonica Intermediate  241 37.30% 34.90% 27.39% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 85.60% 10.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613770354 A -> G LOC_Os06g23600.1 upstream_gene_variant ; 3190.0bp to feature; MODIFIER silent_mutation Average:23.185; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0613770354 A -> G LOC_Os06g23620.1 upstream_gene_variant ; 4998.0bp to feature; MODIFIER silent_mutation Average:23.185; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0613770354 A -> G LOC_Os06g23610.1 downstream_gene_variant ; 702.0bp to feature; MODIFIER silent_mutation Average:23.185; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0613770354 A -> G LOC_Os06g23600-LOC_Os06g23610 intergenic_region ; MODIFIER silent_mutation Average:23.185; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0613770354 A -> DEL N N silent_mutation Average:23.185; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613770354 NA 1.08E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0613770354 2.08E-06 2.08E-06 mr1299 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 1.18E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 5.24E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 2.54E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 3.12E-08 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 4.62E-07 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 2.37E-08 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 6.73E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 8.88E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 5.31E-06 NA mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 3.12E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 2.87E-08 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 3.24E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 4.14E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 2.02E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 2.71E-07 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 3.21E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 2.78E-08 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 1.48E-07 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 2.55E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 6.03E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 8.17E-06 8.16E-06 mr1853 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 3.86E-06 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 3.35E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 6.22E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 2.65E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613770354 NA 1.94E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251