\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613749075:

Variant ID: vg0613749075 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13749075
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAATAAAATAGATAAACCTGACAATCAATTTTCATTTAAATTAGTGAACCCATTAATTTTGATCGTTTGATTTATCTTTACATGAAAACAATCTCCCTC[T/C]
GCAGGTACAAACGATCCCTCCTCGCGCAACATACGTACTATGCAATCCGACATCCATTTCCTTTCTTCTTTTTTATCCCCATAATAATTAAAATTAAAAA

Reverse complement sequence

TTTTTAATTTTAATTATTATGGGGATAAAAAAGAAGAAAGGAAATGGATGTCGGATTGCATAGTACGTATGTTGCGCGAGGAGGGATCGTTTGTACCTGC[A/G]
GAGGGAGATTGTTTTCATGTAAAGATAAATCAAACGATCAAAATTAATGGGTTCACTAATTTAAATGAAAATTGATTGTCAGGTTTATCTATTTTATTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 29.50% 0.13% 0.00% NA
All Indica  2759 97.70% 2.20% 0.11% 0.00% NA
All Japonica  1512 13.80% 86.10% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 95.30% 4.60% 0.13% 0.00% NA
Temperate Japonica  767 5.50% 94.40% 0.13% 0.00% NA
Tropical Japonica  504 17.90% 82.10% 0.00% 0.00% NA
Japonica Intermediate  241 32.00% 68.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613749075 T -> C LOC_Os06g23560.1 upstream_gene_variant ; 3633.0bp to feature; MODIFIER silent_mutation Average:38.025; most accessible tissue: Callus, score: 65.413 N N N N
vg0613749075 T -> C LOC_Os06g23580.1 upstream_gene_variant ; 4396.0bp to feature; MODIFIER silent_mutation Average:38.025; most accessible tissue: Callus, score: 65.413 N N N N
vg0613749075 T -> C LOC_Os06g23570.1 downstream_gene_variant ; 1474.0bp to feature; MODIFIER silent_mutation Average:38.025; most accessible tissue: Callus, score: 65.413 N N N N
vg0613749075 T -> C LOC_Os06g23560-LOC_Os06g23570 intergenic_region ; MODIFIER silent_mutation Average:38.025; most accessible tissue: Callus, score: 65.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613749075 2.84E-12 5.96E-77 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 2.28E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 3.10E-07 4.94E-91 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 1.53E-08 7.31E-85 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 2.09E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 1.67E-07 2.48E-93 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 2.01E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 9.30E-08 2.06E-39 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 5.10E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 9.88E-10 1.01E-100 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 1.00E-25 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 5.48E-28 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 2.75E-08 1.63E-92 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 3.84E-06 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 2.46E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 5.58E-08 5.51E-95 mr1618 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 1.00E-65 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 1.87E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 4.44E-10 5.19E-97 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 1.08E-06 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 5.44E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613749075 NA 1.99E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251