\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613702743:

Variant ID: vg0613702743 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13702743
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TAACTTAAGTTAGTAGGCATGTTGAATTTGGTTGGTTGGTTGCATATCGACATGATGATATTGATGACTAGTGCATCAATAATATAGTAGGTGATGAATA[A/G]
AGGTGGTAAAAAAAACATCTACCGACTTATTCTTATAGGTACGTGCAACACGCAAGTAGATATCGCTGGATATTTGATGATGATATAATATTTTGTATGT

Reverse complement sequence

ACATACAAAATATTATATCATCATCAAATATCCAGCGATATCTACTTGCGTGTTGCACGTACCTATAAGAATAAGTCGGTAGATGTTTTTTTTACCACCT[T/C]
TATTCATCACCTACTATATTATTGATGCACTAGTCATCAATATCATCATGTCGATATGCAACCAACCAACCAAATTCAACATGCCTACTAACTTAAGTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 7.70% 5.99% 0.00% NA
All Indica  2759 77.70% 12.50% 9.86% 0.00% NA
All Japonica  1512 99.00% 0.70% 0.33% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 75.30% 3.50% 21.18% 0.00% NA
Indica II  465 37.60% 44.70% 17.63% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 78.00% 14.00% 8.02% 0.00% NA
Temperate Japonica  767 98.60% 0.90% 0.52% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 10.00% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613702743 A -> G LOC_Os06g23460.1 upstream_gene_variant ; 4817.0bp to feature; MODIFIER silent_mutation Average:47.607; most accessible tissue: Callus, score: 84.022 N N N N
vg0613702743 A -> G LOC_Os06g23470.1 upstream_gene_variant ; 2418.0bp to feature; MODIFIER silent_mutation Average:47.607; most accessible tissue: Callus, score: 84.022 N N N N
vg0613702743 A -> G LOC_Os06g23504.2 upstream_gene_variant ; 2041.0bp to feature; MODIFIER silent_mutation Average:47.607; most accessible tissue: Callus, score: 84.022 N N N N
vg0613702743 A -> G LOC_Os06g23504.1 upstream_gene_variant ; 2041.0bp to feature; MODIFIER silent_mutation Average:47.607; most accessible tissue: Callus, score: 84.022 N N N N
vg0613702743 A -> G LOC_Os06g23480.1 downstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:47.607; most accessible tissue: Callus, score: 84.022 N N N N
vg0613702743 A -> G LOC_Os06g23480-LOC_Os06g23504 intergenic_region ; MODIFIER silent_mutation Average:47.607; most accessible tissue: Callus, score: 84.022 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613702743 NA 1.79E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 NA 2.87E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 NA 3.16E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 1.21E-06 1.95E-25 mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 4.70E-07 5.22E-14 mr1877 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 NA 2.29E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 NA 7.10E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 NA 3.12E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 NA 1.48E-07 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 NA 3.38E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613702743 NA 3.00E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251