\
| Variant ID: vg0613702743 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13702743 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 116. )
TAACTTAAGTTAGTAGGCATGTTGAATTTGGTTGGTTGGTTGCATATCGACATGATGATATTGATGACTAGTGCATCAATAATATAGTAGGTGATGAATA[A/G]
AGGTGGTAAAAAAAACATCTACCGACTTATTCTTATAGGTACGTGCAACACGCAAGTAGATATCGCTGGATATTTGATGATGATATAATATTTTGTATGT
ACATACAAAATATTATATCATCATCAAATATCCAGCGATATCTACTTGCGTGTTGCACGTACCTATAAGAATAAGTCGGTAGATGTTTTTTTTACCACCT[T/C]
TATTCATCACCTACTATATTATTGATGCACTAGTCATCAATATCATCATGTCGATATGCAACCAACCAACCAAATTCAACATGCCTACTAACTTAAGTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.30% | 7.70% | 5.99% | 0.00% | NA |
| All Indica | 2759 | 77.70% | 12.50% | 9.86% | 0.00% | NA |
| All Japonica | 1512 | 99.00% | 0.70% | 0.33% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 75.30% | 3.50% | 21.18% | 0.00% | NA |
| Indica II | 465 | 37.60% | 44.70% | 17.63% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 78.00% | 14.00% | 8.02% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 0.90% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 10.00% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613702743 | A -> G | LOC_Os06g23460.1 | upstream_gene_variant ; 4817.0bp to feature; MODIFIER | silent_mutation | Average:47.607; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0613702743 | A -> G | LOC_Os06g23470.1 | upstream_gene_variant ; 2418.0bp to feature; MODIFIER | silent_mutation | Average:47.607; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0613702743 | A -> G | LOC_Os06g23504.2 | upstream_gene_variant ; 2041.0bp to feature; MODIFIER | silent_mutation | Average:47.607; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0613702743 | A -> G | LOC_Os06g23504.1 | upstream_gene_variant ; 2041.0bp to feature; MODIFIER | silent_mutation | Average:47.607; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0613702743 | A -> G | LOC_Os06g23480.1 | downstream_gene_variant ; 1297.0bp to feature; MODIFIER | silent_mutation | Average:47.607; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| vg0613702743 | A -> G | LOC_Os06g23480-LOC_Os06g23504 | intergenic_region ; MODIFIER | silent_mutation | Average:47.607; most accessible tissue: Callus, score: 84.022 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613702743 | NA | 1.79E-07 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | NA | 2.87E-06 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | NA | 3.16E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | 1.21E-06 | 1.95E-25 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | 4.70E-07 | 5.22E-14 | mr1877 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | NA | 2.29E-09 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | NA | 7.10E-06 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | NA | 3.12E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | NA | 1.48E-07 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | NA | 3.38E-06 | mr1931_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613702743 | NA | 3.00E-06 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |