Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613667272:

Variant ID: vg0613667272 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13667272
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TGCCAGTGCCTGAAGTATTGCGTTATGATTAAAGTTAAGCTTTCCCTAGACACTGTTTCTCACCAGTAAATCCTCTCTATCCTGGCCTATCCTTTGCTTG[G/C]
TGTCTTGGATGAACCGAAGGAAGAACTGACCACACACGTTCCCTTGGATTCGATACCCTTTGGAATACTCTGTAGGGGAAGTGCAACATCGGTATATCCG

Reverse complement sequence

CGGATATACCGATGTTGCACTTCCCCTACAGAGTATTCCAAAGGGTATCGAATCCAAGGGAACGTGTGTGGTCAGTTCTTCCTTCGGTTCATCCAAGACA[C/G]
CAAGCAAAGGATAGGCCAGGATAGAGAGGATTTACTGGTGAGAAACAGTGTCTAGGGAAAGCTTAACTTTAATCATAACGCAATACTTCAGGCACTGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	31.70%	3.07%	4.59%	NA
All Indica	2759	95.60%	2.50%	1.81%	0.11%	NA
All Japonica	1512	2.40%	92.00%	0.53%	5.09%	NA
Aus	269	51.70%	1.10%	3.72%	43.49%	NA
Indica I	595	93.80%	2.40%	3.87%	0.00%	NA
Indica II	465	97.00%	2.80%	0.00%	0.22%	NA
Indica III	913	97.70%	0.40%	1.64%	0.22%	NA
Indica Intermediate	786	93.60%	4.80%	1.53%	0.00%	NA
Temperate Japonica	767	3.70%	96.20%	0.00%	0.13%	NA
Tropical Japonica	504	1.00%	85.70%	0.99%	12.30%	NA
Japonica Intermediate	241	1.20%	91.70%	1.24%	5.81%	NA
VI/Aromatic	96	12.50%	4.20%	68.75%	14.58%	NA
Intermediate	90	47.80%	33.30%	12.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613667272	G -> C	LOC_Os06g23410.1	upstream_gene_variant ; 1784.0bp to feature; MODIFIER	silent_mutation	Average:52.722; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0613667272	G -> C	LOC_Os06g23400.1	downstream_gene_variant ; 2460.0bp to feature; MODIFIER	silent_mutation	Average:52.722; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0613667272	G -> C	LOC_Os06g23400-LOC_Os06g23410	intergenic_region ; MODIFIER	silent_mutation	Average:52.722; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N
vg0613667272	G -> DEL	N	N	silent_mutation	Average:52.722; most accessible tissue: Minghui63 flag leaf, score: 76.453	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613667272	NA	1.87E-21	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	3.90E-38	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	1.38E-44	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	3.03E-42	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	1.34E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	1.30E-20	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	2.60E-59	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	5.98E-06	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	1.26E-69	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	1.14E-17	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	1.42E-54	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	2.91E-08	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	8.01E-22	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	4.48E-06	NA	mr1619_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	3.65E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	3.19E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613667272	NA	1.55E-15	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251