Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613607173:

Variant ID: vg0613607173 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13607173
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

CTACAATTTTGATATAAAGTTTGTCTTCATTAGATTTTGCATGAAAAAGTTATAAATTATTTTTTGATATAAAGTTTTTTGACCGTCCTGTTTAGGGACC[G/A]
GGGTGACACAACTGAACAAGTTGGAGGATCTAAACGAGTGATTTACAAGTTTAGAGACCGGAATGACACAGTGAAACAAGTTTGAGAACCTGAACGGTCG

Reverse complement sequence

CGACCGTTCAGGTTCTCAAACTTGTTTCACTGTGTCATTCCGGTCTCTAAACTTGTAAATCACTCGTTTAGATCCTCCAACTTGTTCAGTTGTGTCACCC[C/T]
GGTCCCTAAACAGGACGGTCAAAAAACTTTATATCAAAAAATAATTTATAACTTTTTCATGCAAAATCTAATGAAGACAAACTTTATATCAAAATTGTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.20%	9.00%	2.01%	56.75%	NA
All Indica	2759	3.20%	6.80%	2.21%	87.82%	NA
All Japonica	1512	92.10%	3.80%	0.79%	3.31%	NA
Aus	269	1.10%	41.30%	6.32%	51.30%	NA
Indica I	595	3.00%	2.40%	4.20%	90.42%	NA
Indica II	465	4.30%	1.90%	0.65%	93.12%	NA
Indica III	913	0.90%	13.50%	1.64%	84.01%	NA
Indica Intermediate	786	5.30%	5.20%	2.29%	87.15%	NA
Temperate Japonica	767	96.50%	0.30%	0.13%	3.13%	NA
Tropical Japonica	504	85.50%	8.90%	1.79%	3.77%	NA
Japonica Intermediate	241	91.70%	4.60%	0.83%	2.90%	NA
VI/Aromatic	96	2.10%	63.50%	2.08%	32.29%	NA
Intermediate	90	41.10%	11.10%	3.33%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613607173	G -> A	LOC_Os06g23290.1	upstream_gene_variant ; 2256.0bp to feature; MODIFIER	silent_mutation	Average:76.822; most accessible tissue: Minghui63 root, score: 96.69	N	N	N	N
vg0613607173	G -> A	LOC_Os06g23300.1	upstream_gene_variant ; 2894.0bp to feature; MODIFIER	silent_mutation	Average:76.822; most accessible tissue: Minghui63 root, score: 96.69	N	N	N	N
vg0613607173	G -> A	LOC_Os06g23290.2	upstream_gene_variant ; 2257.0bp to feature; MODIFIER	silent_mutation	Average:76.822; most accessible tissue: Minghui63 root, score: 96.69	N	N	N	N
vg0613607173	G -> A	LOC_Os06g23290.3	upstream_gene_variant ; 2256.0bp to feature; MODIFIER	silent_mutation	Average:76.822; most accessible tissue: Minghui63 root, score: 96.69	N	N	N	N
vg0613607173	G -> A	LOC_Os06g23290.4	upstream_gene_variant ; 2256.0bp to feature; MODIFIER	silent_mutation	Average:76.822; most accessible tissue: Minghui63 root, score: 96.69	N	N	N	N
vg0613607173	G -> A	LOC_Os06g23290.5	upstream_gene_variant ; 2256.0bp to feature; MODIFIER	silent_mutation	Average:76.822; most accessible tissue: Minghui63 root, score: 96.69	N	N	N	N
vg0613607173	G -> A	LOC_Os06g23290.6	upstream_gene_variant ; 2256.0bp to feature; MODIFIER	silent_mutation	Average:76.822; most accessible tissue: Minghui63 root, score: 96.69	N	N	N	N
vg0613607173	G -> A	LOC_Os06g23290-LOC_Os06g23300	intergenic_region ; MODIFIER	silent_mutation	Average:76.822; most accessible tissue: Minghui63 root, score: 96.69	N	N	N	N
vg0613607173	G -> DEL	N	N	silent_mutation	Average:76.822; most accessible tissue: Minghui63 root, score: 96.69	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613607173	NA	2.80E-06	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	3.22E-07	3.22E-07	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	5.90E-10	3.23E-79	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	3.17E-06	1.80E-11	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	4.52E-06	4.15E-12	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	6.33E-06	6.33E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	9.03E-07	5.07E-42	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	NA	1.17E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	7.99E-06	5.97E-08	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	NA	9.84E-09	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	NA	6.95E-08	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	1.17E-07	1.17E-07	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	4.79E-07	4.79E-07	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	NA	2.89E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	NA	1.28E-07	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	1.10E-12	4.70E-108	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	3.00E-08	4.55E-19	mr1033_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	3.01E-07	6.20E-16	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	NA	3.12E-08	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613607173	6.67E-06	4.94E-09	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251