\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613606148:

Variant ID: vg0613606148 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13606148
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAACAAAACAAACTACAGATTCCGCCTGTAAACTGCGACACAAATTTATTAAGCCTAATTAATTTGTTATTAGCAAATGTTTACTGTAGCATCATATT[G/A]
TCAAATTATGGTATAATTAGGCTTAAAAAATTCGTCTCGCAATTTACATGCAAACTGTGTAATTGGTTTTTTTTCATATTTAATGCTTTATGTATGTGTT

Reverse complement sequence

AACACATACATAAAGCATTAAATATGAAAAAAAACCAATTACACAGTTTGCATGTAAATTGCGAGACGAATTTTTTAAGCCTAATTATACCATAATTTGA[C/T]
AATATGATGCTACAGTAAACATTTGCTAATAACAAATTAATTAGGCTTAATAAATTTGTGTCGCAGTTTACAGGCGGAATCTGTAGTTTGTTTTGTTAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 38.80% 0.00% 0.00% NA
All Indica  2759 96.60% 3.40% 0.00% 0.00% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 51.70% 48.30% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.70% 0.00% 0.00% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613606148 G -> A LOC_Os06g23290.1 upstream_gene_variant ; 1231.0bp to feature; MODIFIER silent_mutation Average:92.65; most accessible tissue: Minghui63 root, score: 99.441 N N N N
vg0613606148 G -> A LOC_Os06g23300.1 upstream_gene_variant ; 3919.0bp to feature; MODIFIER silent_mutation Average:92.65; most accessible tissue: Minghui63 root, score: 99.441 N N N N
vg0613606148 G -> A LOC_Os06g23290.2 upstream_gene_variant ; 1232.0bp to feature; MODIFIER silent_mutation Average:92.65; most accessible tissue: Minghui63 root, score: 99.441 N N N N
vg0613606148 G -> A LOC_Os06g23290.3 upstream_gene_variant ; 1231.0bp to feature; MODIFIER silent_mutation Average:92.65; most accessible tissue: Minghui63 root, score: 99.441 N N N N
vg0613606148 G -> A LOC_Os06g23290.4 upstream_gene_variant ; 1231.0bp to feature; MODIFIER silent_mutation Average:92.65; most accessible tissue: Minghui63 root, score: 99.441 N N N N
vg0613606148 G -> A LOC_Os06g23290.5 upstream_gene_variant ; 1231.0bp to feature; MODIFIER silent_mutation Average:92.65; most accessible tissue: Minghui63 root, score: 99.441 N N N N
vg0613606148 G -> A LOC_Os06g23290.6 upstream_gene_variant ; 1231.0bp to feature; MODIFIER silent_mutation Average:92.65; most accessible tissue: Minghui63 root, score: 99.441 N N N N
vg0613606148 G -> A LOC_Os06g23290-LOC_Os06g23300 intergenic_region ; MODIFIER silent_mutation Average:92.65; most accessible tissue: Minghui63 root, score: 99.441 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0613606148 G A 0.01 0.02 0.01 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613606148 NA 1.57E-16 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0613606148 NA 1.56E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 2.06E-44 mr1064 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 1.34E-42 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 4.52E-26 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 2.63E-38 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 3.69E-57 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 2.86E-27 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 3.78E-22 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 7.67E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 6.12E-31 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 2.32E-30 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 3.38E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 3.95E-27 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 1.25E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 5.44E-48 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 9.47E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 2.86E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 1.65E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 1.03E-51 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 1.81E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 4.69E-79 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 5.67E-59 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 1.00E-55 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 9.02E-31 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 3.43E-93 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 2.22E-08 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 2.35E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613606148 NA 3.09E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251