\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613552011:

Variant ID: vg0613552011 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13552011
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GACAAGGAATTTTATACAGGTTCAGGCCTTCTTAATCAAGAAGTAATACTCTACTCCTGTCCGGGGATTGATCCGCCGAGTGTATTATTGATCGTATGAT[C/T]
TAGGAAGAAATCGTGCCCCTAAAGACACCCGGACCCCTCCTTATATAGGGGAAGGGGTCTGCATTACAAAAAACAATCCATATCCCTAACGGAATATGTA

Reverse complement sequence

TACATATTCCGTTAGGGATATGGATTGTTTTTTGTAATGCAGACCCCTTCCCCTATATAAGGAGGGGTCCGGGTGTCTTTAGGGGCACGATTTCTTCCTA[G/A]
ATCATACGATCAATAATACACTCGGCGGATCAATCCCCGGACAGGAGTAGAGTATTACTTCTTGATTAAGAAGGCCTGAACCTGTATAAAATTCCTTGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 31.60% 0.23% 0.00% NA
All Indica  2759 97.20% 2.50% 0.25% 0.00% NA
All Japonica  1512 8.10% 91.80% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 96.60% 3.00% 0.43% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 95.40% 4.30% 0.25% 0.00% NA
Temperate Japonica  767 3.80% 96.00% 0.26% 0.00% NA
Tropical Japonica  504 14.50% 85.50% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 62.20% 35.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613552011 C -> T LOC_Os06g23200.1 upstream_gene_variant ; 504.0bp to feature; MODIFIER silent_mutation Average:63.239; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N
vg0613552011 C -> T LOC_Os06g23210.1 upstream_gene_variant ; 2699.0bp to feature; MODIFIER silent_mutation Average:63.239; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N
vg0613552011 C -> T LOC_Os06g23200-LOC_Os06g23210 intergenic_region ; MODIFIER silent_mutation Average:63.239; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613552011 NA 2.80E-06 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 3.22E-07 3.22E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 5.56E-76 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 5.50E-09 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 4.52E-06 4.15E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 5.08E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 5.13E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 6.33E-06 6.33E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 2.26E-06 1.03E-41 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 2.71E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 7.99E-06 5.97E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 5.54E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 1.06E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 8.37E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 1.17E-07 1.17E-07 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 4.79E-07 4.79E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 1.28E-07 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 2.45E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 1.37E-09 4.65E-108 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 2.87E-17 mr1033_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 3.01E-07 6.20E-16 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 6.67E-06 4.94E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613552011 NA 2.06E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251