Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613545500:

Variant ID: vg0613545500 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13545500
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCAGTGCTTTTCTGGATTTCATCAGAGATATGGTACGTACATCGGTGTATTGCAGACCGCATGCGAGCAATCCTAGTCATTAGAAGGAATTAGTTAAA[T/C]
ATTGCAAGTAAAAGAATTTAAATATATTAATTGTGTGGAGCATTACCGGTCAGTATATATGCACTAGCAGCTTCTCCCTTATTTGCAGTTGTTCTTTACC

Reverse complement sequence

GGTAAAGAACAACTGCAAATAAGGGAGAAGCTGCTAGTGCATATATACTGACCGGTAATGCTCCACACAATTAATATATTTAAATTCTTTTACTTGCAAT[A/G]
TTTAACTAATTCCTTCTAATGACTAGGATTGCTCGCATGCGGTCTGCAATACACCGATGTACGTACCATATCTCTGATGAAATCCAGAAAAGCACTGAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	17.00%	0.34%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	47.40%	51.60%	1.06%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	12.40%	86.40%	1.17%	0.00%	NA
Tropical Japonica	504	94.80%	4.80%	0.40%	0.00%	NA
Japonica Intermediate	241	59.30%	38.60%	2.07%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613545500	T -> C	LOC_Os06g23190.1	downstream_gene_variant ; 666.0bp to feature; MODIFIER	silent_mutation	Average:68.383; most accessible tissue: Callus, score: 90.466	N	N	N	N
vg0613545500	T -> C	LOC_Os06g23200.1	downstream_gene_variant ; 3548.0bp to feature; MODIFIER	silent_mutation	Average:68.383; most accessible tissue: Callus, score: 90.466	N	N	N	N
vg0613545500	T -> C	LOC_Os06g23190-LOC_Os06g23200	intergenic_region ; MODIFIER	silent_mutation	Average:68.383; most accessible tissue: Callus, score: 90.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613545500	NA	1.70E-23	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	5.41E-31	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	1.39E-11	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	1.20E-11	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	4.59E-13	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	3.43E-11	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	3.95E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	1.61E-25	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	3.45E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	4.50E-06	NA	mr1355_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	6.31E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	3.86E-08	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	5.08E-07	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	2.70E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	4.53E-06	NA	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	8.48E-06	mr1761_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	5.56E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	8.69E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	5.45E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613545500	NA	3.47E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251