\
| Variant ID: vg0613480388 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13480388 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AACGATTTTGTCCCAATAATGCCATCGCCGTTACGATTCCGTCCACCCCACGCCGTTACATACACTGTTCATCATATAGCTCTTAATGGTGCGGGATGGA[C/T]
GGAACCCTAACGACGATGGCATTTTTGGGACAAAATCGTTTGTACGATGATATTTCTTGAAACTCACACTTGTCGGTGGCATTTTTTGGATTTAAACGCT
AGCGTTTAAATCCAAAAAATGCCACCGACAAGTGTGAGTTTCAAGAAATATCATCGTACAAACGATTTTGTCCCAAAAATGCCATCGTCGTTAGGGTTCC[G/A]
TCCATCCCGCACCATTAAGAGCTATATGATGAACAGTGTATGTAACGGCGTGGGGTGGACGGAATCGTAACGGCGATGGCATTATTGGGACAAAATCGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.90% | 33.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 10.40% | 89.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 21.80% | 78.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613480388 | C -> T | LOC_Os06g23114.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.195; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613480388 | NA | 1.10E-21 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 6.38E-26 | 7.86E-97 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 9.41E-15 | 2.44E-20 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 1.18E-15 | 1.47E-51 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 6.70E-10 | 3.45E-13 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 4.38E-12 | 3.71E-82 | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 3.09E-09 | 3.09E-09 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | NA | 4.34E-34 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | NA | 6.18E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | NA | 1.25E-20 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 2.43E-29 | 1.00E-125 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 2.79E-18 | 1.03E-27 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | NA | 7.79E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 6.68E-14 | 1.04E-108 | mr1536_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | 1.53E-10 | 3.70E-12 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613480388 | NA | 2.80E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |