\
| Variant ID: vg0613478814 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13478814 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTATTACAACATTTTATTTAAATTTAATAAGTATTGAAAAATTACTTAGAATTCATAAAAACAATCCATAATATCTCTAGTACTTTTAATAAAAAAAGGT[G/A]
ACTATAAAACTTTCTATATTAATTAATTGGAAAAAAAGCTACATATTTAGTTGGCACTACGAGACCATAAGCAGTAGCCATGATATCAGGGCGTAGGTGC
GCACCTACGCCCTGATATCATGGCTACTGCTTATGGTCTCGTAGTGCCAACTAAATATGTAGCTTTTTTTCCAATTAATTAATATAGAAAGTTTTATAGT[C/T]
ACCTTTTTTTATTAAAAGTACTAGAGATATTATGGATTGTTTTTATGAATTCTAAGTAATTTTTCAATACTTATTAAATTTAAATAAAATGTTGTAATAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 8.90% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 74.40% | 24.40% | 1.19% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 2.90% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 39.90% | 58.50% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 21.60% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 10.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613478814 | G -> A | LOC_Os06g23114.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.133; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613478814 | 1.56E-08 | NA | mr1033 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | 3.02E-07 | 8.33E-29 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | NA | 5.89E-14 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | 4.80E-06 | 3.22E-18 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | NA | 2.69E-08 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | NA | 9.21E-11 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | NA | 8.86E-08 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | 4.15E-13 | NA | mr1033_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | 1.92E-06 | 5.96E-29 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | NA | 3.61E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | NA | 3.83E-19 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | NA | 2.52E-11 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478814 | NA | 7.63E-13 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |