\
| Variant ID: vg0613478027 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13478027 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACTAAAACCTGGAGGATTCTTTTGTCCATGCATGCACGTGTGATTCCGAAAAAGGATGTGTTTGTGCCAAATGAGGACGATCACGCCAGGACAAAATTA[A/T]
AGTGGGGCTCATCAGCCTTTTGGACCTTCTAACCATCTCAAACAAAGTCTATTTTAGCCCCCTTACAATAGATATATGGATTTAAATTTTAGGGCGGTCT
AGACCGCCCTAAAATTTAAATCCATATATCTATTGTAAGGGGGCTAAAATAGACTTTGTTTGAGATGGTTAGAAGGTCCAAAAGGCTGATGAGCCCCACT[T/A]
TAATTTTGTCCTGGCGTGATCGTCCTCATTTGGCACAAACACATCCTTTTTCGGAATCACACGTGCATGCATGGACAAAAGAATCCTCCAGGTTTTAGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.20% | 30.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 10.60% | 89.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 22.00% | 78.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613478027 | A -> T | LOC_Os06g23100.1 | downstream_gene_variant ; 4778.0bp to feature; MODIFIER | silent_mutation | Average:69.697; most accessible tissue: Callus, score: 92.574 | N | N | N | N |
| vg0613478027 | A -> T | LOC_Os06g23114.1 | intron_variant ; MODIFIER | silent_mutation | Average:69.697; most accessible tissue: Callus, score: 92.574 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613478027 | NA | 1.11E-21 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 1.70E-27 | 1.70E-95 | mr1033 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 9.41E-15 | 2.44E-20 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 4.49E-17 | 5.98E-51 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 6.70E-10 | 3.45E-13 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | NA | 1.12E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 1.28E-11 | 1.37E-76 | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 3.09E-09 | 3.09E-09 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | NA | 3.71E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | NA | 5.11E-21 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 4.43E-35 | 4.68E-130 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 2.79E-18 | 1.03E-27 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | NA | 5.22E-20 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | NA | 4.13E-30 | mr1477_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 4.80E-14 | 3.41E-98 | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | 1.53E-10 | 3.70E-12 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613478027 | NA | 8.18E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |