\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613473372:

Variant ID: vg0613473372 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13473372
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGATCCCACATGGCGGCAGAGGTTGAGTGGTGGTGGATTGTTGTTCTAGCGGCGGTCAGTCACGCTTAGCGGCGATCGGTCCGGTGCTAGCCTTCTCCC[A/G]
GGCTTATGTGTTGGCGCTGTCGGTGTGTGATTGGTGGTATATTTTTTCTTTTTTCTTGGTTACGACTCTCTAGGGTTGTAATCTTGTAATTTTTTCATGC

Reverse complement sequence

GCATGAAAAAATTACAAGATTACAACCCTAGAGAGTCGTAACCAAGAAAAAAGAAAAAATATACCACCAATCACACACCGACAGCGCCAACACATAAGCC[T/C]
GGGAGAAGGCTAGCACCGGACCGATCGCCGCTAAGCGTGACTGACCGCCGCTAGAACAACAATCCACCACCACTCAACCTCTGCCGCCATGTGGGATCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 31.00% 0.00% 0.00% NA
All Indica  2759 97.50% 2.50% 0.00% 0.00% NA
All Japonica  1512 10.60% 89.40% 0.00% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 22.00% 78.00% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613473372 A -> G LOC_Os06g23114.1 upstream_gene_variant ; 3115.0bp to feature; MODIFIER silent_mutation Average:70.612; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N
vg0613473372 A -> G LOC_Os06g23090.1 downstream_gene_variant ; 4114.0bp to feature; MODIFIER silent_mutation Average:70.612; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N
vg0613473372 A -> G LOC_Os06g23100.1 downstream_gene_variant ; 123.0bp to feature; MODIFIER silent_mutation Average:70.612; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N
vg0613473372 A -> G LOC_Os06g23100-LOC_Os06g23114 intergenic_region ; MODIFIER silent_mutation Average:70.612; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613473372 NA 1.37E-21 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 9.20E-23 2.40E-88 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 9.41E-15 2.44E-20 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 NA 2.67E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 8.74E-14 5.32E-47 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 6.70E-10 3.45E-13 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 NA 7.67E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 NA 5.03E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 NA 5.32E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 8.15E-12 1.17E-76 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 3.09E-09 3.09E-09 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 NA 3.89E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 6.71E-26 9.17E-117 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 2.79E-18 1.03E-27 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 NA 7.22E-20 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 NA 2.19E-30 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 1.58E-14 3.74E-98 mr1536_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613473372 1.53E-10 3.70E-12 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251