\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613465771:

Variant ID: vg0613465771 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13465771
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCCCACTTATCTCACTTTTTGTTTATTTTTCTTCTAAATTTTATACTATCGTGTAAAAAATAAACTAGCAAGCACGATTTTAAGCAGATAGTGAGACTA[C/T]
CCACTTGCATACATAGCCTTGCCTCCTCCCCTTGTATGCGCGCCACACGTTCATCCGCGCGGGGAAGGGGCGCACGACCAGTCGCTAAATAGCGATTTCC

Reverse complement sequence

GGAAATCGCTATTTAGCGACTGGTCGTGCGCCCCTTCCCCGCGCGGATGAACGTGTGGCGCGCATACAAGGGGAGGAGGCAAGGCTATGTATGCAAGTGG[G/A]
TAGTCTCACTATCTGCTTAAAATCGTGCTTGCTAGTTTATTTTTTACACGATAGTATAAAATTTAGAAGAAAAATAAACAAAAAGTGAGATAAGTGGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 8.40% 0.25% 0.00% NA
All Indica  2759 98.00% 2.00% 0.04% 0.00% NA
All Japonica  1512 91.10% 8.10% 0.73% 0.00% NA
Aus  269 56.90% 43.10% 0.00% 0.00% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.40% 0.13% 0.00% NA
Temperate Japonica  767 98.70% 0.30% 1.04% 0.00% NA
Tropical Japonica  504 80.00% 19.80% 0.20% 0.00% NA
Japonica Intermediate  241 90.50% 8.70% 0.83% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613465771 C -> T LOC_Os06g23090.1 intron_variant ; MODIFIER silent_mutation Average:91.247; most accessible tissue: Callus, score: 96.6 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0613465771 C T -0.01 0.02 0.03 -0.04 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613465771 3.53E-10 4.19E-14 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613465771 NA 1.14E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613465771 2.63E-15 NA mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613465771 1.79E-15 5.76E-21 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613465771 4.14E-08 NA mr1536_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613465771 5.13E-10 2.31E-11 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613465771 NA 1.04E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251