| Variant ID: vg0613463494 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13463494 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCCTTATCATATTCGATTCTGTTTCTGAGAAAATATTTCTAAATTTGTTTCCGTTTCTGAAATATTCCGACCGACATATTTCATTTTTGAAAATAGGTC[C/T]
GGAATCCAGAAAATTTTCGTACCGTTTTCATCCCTATACGAAATTAGGAAGGGCGCTCTAGTCGAAAGCGTCCTTAGGGCAGACACTGTTGGGGGGGCCT
AGGCCCCCCCAACAGTGTCTGCCCTAAGGACGCTTTCGACTAGAGCGCCCTTCCTAATTTCGTATAGGGATGAAAACGGTACGAAAATTTTCTGGATTCC[G/A]
GACCTATTTTCAAAAATGAAATATGTCGGTCGGAATATTTCAGAAACGGAAACAAATTTAGAAATATTTTCTCAGAAACAGAATCGAATATGATAAGGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 6.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.50% | 7.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 52.40% | 47.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.60% | 19.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613463494 | C -> T | LOC_Os06g23090.1 | upstream_gene_variant ; 531.0bp to feature; MODIFIER | silent_mutation | Average:69.772; most accessible tissue: Callus, score: 98.015 | N | N | N | N |
| vg0613463494 | C -> T | LOC_Os06g23080-LOC_Os06g23090 | intergenic_region ; MODIFIER | silent_mutation | Average:69.772; most accessible tissue: Callus, score: 98.015 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613463494 | 4.12E-11 | NA | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613463494 | 7.31E-13 | 4.27E-17 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613463494 | 1.30E-06 | NA | mr1176 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613463494 | 2.49E-07 | 3.58E-11 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613463494 | 4.84E-16 | NA | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613463494 | 1.55E-16 | 1.09E-22 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613463494 | 2.68E-06 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613463494 | 9.54E-08 | 2.99E-09 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |