Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613461816:

Variant ID: vg0613461816 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13461816
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGATTCGGTTGCTATGTTGCTTTGTTTCTTATTAAGACAGTGTATAGAGCCTCGGCTGAGTAGTACCATATAATAGATTAGAAACTGATGCTGTGTCC[G/A]
GCTAGGTTCCCCTTTGTAACCATGCCCCCAACCTATATAAGGCGGGCAAGGAGCCCCCTCAAGGGCAATACACACACATAACCACTATCAGATCGTCACA

Reverse complement sequence

TGTGACGATCTGATAGTGGTTATGTGTGTGTATTGCCCTTGAGGGGGCTCCTTGCCCGCCTTATATAGGTTGGGGGCATGGTTACAAAGGGGAACCTAGC[C/T]
GGACACAGCATCAGTTTCTAATCTATTATATGGTACTACTCAGCCGAGGCTCTATACACTGTCTTAATAAGAAACAAAGCAACATAGCAACCGAATCCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.70%	5.30%	0.02%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	92.50%	7.50%	0.07%	0.00%	NA
Aus	269	56.50%	43.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	80.60%	19.20%	0.20%	0.00%	NA
Japonica Intermediate	241	94.20%	5.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613461816	G -> A	LOC_Os06g23080.1	upstream_gene_variant ; 3939.0bp to feature; MODIFIER	silent_mutation	Average:73.102; most accessible tissue: Callus, score: 85.742	N	N	N	N
vg0613461816	G -> A	LOC_Os06g23090.1	upstream_gene_variant ; 2209.0bp to feature; MODIFIER	silent_mutation	Average:73.102; most accessible tissue: Callus, score: 85.742	N	N	N	N
vg0613461816	G -> A	LOC_Os06g23080-LOC_Os06g23090	intergenic_region ; MODIFIER	silent_mutation	Average:73.102; most accessible tissue: Callus, score: 85.742	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613461816	3.87E-12	NA	mr1033	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613461816	5.47E-13	1.36E-17	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613461816	3.19E-06	NA	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613461816	1.63E-07	4.72E-11	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613461816	2.88E-16	NA	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613461816	2.33E-13	5.42E-21	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613461816	3.04E-06	NA	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251