\
| Variant ID: vg0613461816 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13461816 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )
TAGGATTCGGTTGCTATGTTGCTTTGTTTCTTATTAAGACAGTGTATAGAGCCTCGGCTGAGTAGTACCATATAATAGATTAGAAACTGATGCTGTGTCC[G/A]
GCTAGGTTCCCCTTTGTAACCATGCCCCCAACCTATATAAGGCGGGCAAGGAGCCCCCTCAAGGGCAATACACACACATAACCACTATCAGATCGTCACA
TGTGACGATCTGATAGTGGTTATGTGTGTGTATTGCCCTTGAGGGGGCTCCTTGCCCGCCTTATATAGGTTGGGGGCATGGTTACAAAGGGGAACCTAGC[C/T]
GGACACAGCATCAGTTTCTAATCTATTATATGGTACTACTCAGCCGAGGCTCTATACACTGTCTTAATAAGAAACAAAGCAACATAGCAACCGAATCCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 5.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.50% | 7.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.60% | 19.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613461816 | G -> A | LOC_Os06g23080.1 | upstream_gene_variant ; 3939.0bp to feature; MODIFIER | silent_mutation | Average:73.102; most accessible tissue: Callus, score: 85.742 | N | N | N | N |
| vg0613461816 | G -> A | LOC_Os06g23090.1 | upstream_gene_variant ; 2209.0bp to feature; MODIFIER | silent_mutation | Average:73.102; most accessible tissue: Callus, score: 85.742 | N | N | N | N |
| vg0613461816 | G -> A | LOC_Os06g23080-LOC_Os06g23090 | intergenic_region ; MODIFIER | silent_mutation | Average:73.102; most accessible tissue: Callus, score: 85.742 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613461816 | 3.87E-12 | NA | mr1033 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613461816 | 5.47E-13 | 1.36E-17 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613461816 | 3.19E-06 | NA | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613461816 | 1.63E-07 | 4.72E-11 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613461816 | 2.88E-16 | NA | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613461816 | 2.33E-13 | 5.42E-21 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613461816 | 3.04E-06 | NA | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |