\
| Variant ID: vg0613452440 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13452440 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )
GCGAGCGGGGGATGCCCTTTTTCAAGCTGTTGAAGAAAACAGACAACTTCCAATGGGGACCCGAAGCCCAAAAAGCCTTCGAAGACTTCAAAAAACTCCT[T/C]
ACTACTCCACCAGTCTTAGCTTCGCCACATCCGCAAGAGCCGTTGTTGTTATATGTATCGGCAACTTCCCAGGTTATAAGCACAGTCCTGGTCGTCGAGC
GCTCGACGACCAGGACTGTGCTTATAACCTGGGAAGTTGCCGATACATATAACAACAACGGCTCTTGCGGATGTGGCGAAGCTAAGACTGGTGGAGTAGT[A/G]
AGGAGTTTTTTGAAGTCTTCGAAGGCTTTTTGGGCTTCGGGTCCCCATTGGAAGTTGTCTGTTTTCTTCAACAGCTTGAAAAAGGGCATCCCCCGCTCGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 33.80% | 0.30% | 1.99% | NA |
| All Indica | 2759 | 97.10% | 2.70% | 0.07% | 0.11% | NA |
| All Japonica | 1512 | 3.00% | 93.50% | 0.46% | 3.04% | NA |
| Aus | 269 | 55.80% | 28.30% | 0.74% | 15.24% | NA |
| Indica I | 595 | 97.10% | 2.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.50% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 3.70% | 94.40% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 2.20% | 92.50% | 0.99% | 4.37% | NA |
| Japonica Intermediate | 241 | 2.50% | 92.90% | 0.83% | 3.73% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 56.70% | 36.70% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613452440 | T -> C | LOC_Os06g23070.1 | synonymous_variant ; p.Leu835Leu; LOW | synonymous_codon | Average:48.957; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0613452440 | T -> DEL | LOC_Os06g23070.1 | N | frameshift_variant | Average:48.957; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613452440 | NA | 1.45E-21 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | 2.64E-25 | 4.18E-93 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | 4.56E-14 | 3.39E-20 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | 4.25E-18 | 1.97E-51 | mr1176 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | 2.93E-11 | 1.36E-14 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | NA | 1.43E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | 4.99E-08 | 4.25E-72 | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | 1.60E-07 | 1.60E-07 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | NA | 3.92E-21 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | 1.85E-33 | 3.00E-129 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | 9.83E-17 | 5.64E-26 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | NA | 4.88E-20 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | NA | 9.48E-30 | mr1477_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | 1.06E-08 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | NA | 2.69E-09 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613452440 | NA | 2.52E-08 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |