\
| Variant ID: vg0613448734 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13448734 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCTCCGCCCCGTTCGGTATCCCGAACTCGGCCGAGATCTACCCCAAGGTCATCTCCGACGAGTCAGTTTCAAACCACTCGGACGAGATCCAATCTACTT[T/C]
AACACCACCAGATCAAGACGATGGGGCCTACCCGCCAATCCTGATGAAACTCCTCGACGATCTGGCTGCCGTCTTTACTACAAGGGCGTCTTCTCCCCGT
ACGGGGAGAAGACGCCCTTGTAGTAAAGACGGCAGCCAGATCGTCGAGGAGTTTCATCAGGATTGGCGGGTAGGCCCCATCGTCTTGATCTGGTGGTGTT[A/G]
AAGTAGATTGGATCTCGTCCGAGTGGTTTGAAACTGACTCGTCGGAGATGACCTTGGGGTAGATCTCGGCCGAGTTCGGGATACCGAACGGGGCGGAGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 30.80% | 1.02% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 2.50% | 1.63% | 0.00% | NA |
| All Japonica | 1512 | 10.30% | 89.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.60% | 2.70% | 3.70% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.20% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 4.10% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 21.20% | 78.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.30% | 91.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 32.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613448734 | T -> C | LOC_Os06g23070.1 | missense_variant ; p.Leu81Ser; MODERATE | nonsynonymous_codon ; L81S | Average:63.081; most accessible tissue: Minghui63 flag leaf, score: 80.241 | benign |
0.095 |
TOLERATED | 0.49 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613448734 | NA | 1.28E-21 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 9.05E-20 | 1.83E-88 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 2.42E-11 | 5.83E-19 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | NA | 2.75E-69 | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 2.11E-12 | 3.66E-48 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 6.12E-08 | 2.76E-12 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | NA | 1.35E-54 | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | NA | 4.18E-21 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 1.51E-11 | 8.85E-74 | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 3.60E-11 | 3.60E-11 | mr1536 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | NA | 3.29E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | NA | 3.98E-21 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 9.52E-26 | 1.91E-122 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 1.69E-11 | 2.24E-21 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 6.10E-12 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | 1.11E-09 | 3.70E-10 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | NA | 2.27E-08 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613448734 | NA | 3.19E-14 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |