\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613439992:

Variant ID: vg0613439992 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13439992
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGCCGCTGTCGCAAACGTGCTCAACTTCATTGTGGGTTGCGGCGGAGCCACCGATTTCTTTGATTCTCTTTTTCTCTTTCTCTTTTCTTTGATTTCTTC[T/C]
TTCCTTTTTTTTTTCTTCCTAATGGCTGACGTGCCGTGGCTTGGCACGGGTGACGGCGTGACGCGGACGAAGCTGGGCGACAGTGGCGCGGCGAGGTCGG

Reverse complement sequence

CCGACCTCGCCGCGCCACTGTCGCCCAGCTTCGTCCGCGTCACGCCGTCACCCGTGCCAAGCCACGGCACGTCAGCCATTAGGAAGAAAAAAAAAAGGAA[A/G]
GAAGAAATCAAAGAAAAGAGAAAGAGAAAAAGAGAATCAAAGAAATCGGTGGCTCCGCCGCAACCCACAATGAAGTTGAGCACGTTTGCGACAGCGGCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 25.30% 8.17% 27.44% NA
All Indica  2759 5.70% 40.00% 10.91% 43.42% NA
All Japonica  1512 95.00% 0.50% 2.98% 1.52% NA
Aus  269 44.60% 24.20% 11.15% 20.07% NA
Indica I  595 6.70% 27.60% 16.47% 49.24% NA
Indica II  465 6.00% 29.00% 9.46% 55.48% NA
Indica III  913 1.90% 57.30% 7.67% 33.19% NA
Indica Intermediate  786 9.20% 35.80% 11.32% 43.77% NA
Temperate Japonica  767 96.60% 0.80% 0.26% 2.35% NA
Tropical Japonica  504 91.10% 0.40% 8.13% 0.40% NA
Japonica Intermediate  241 97.90% 0.00% 0.83% 1.24% NA
VI/Aromatic  96 87.50% 4.20% 3.12% 5.21% NA
Intermediate  90 57.80% 15.60% 7.78% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613439992 T -> C LOC_Os06g23020.1 upstream_gene_variant ; 4053.0bp to feature; MODIFIER silent_mutation Average:86.572; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0613439992 T -> C LOC_Os06g23030.1 upstream_gene_variant ; 70.0bp to feature; MODIFIER silent_mutation Average:86.572; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0613439992 T -> C LOC_Os06g23040.1 upstream_gene_variant ; 860.0bp to feature; MODIFIER silent_mutation Average:86.572; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0613439992 T -> C LOC_Os06g23050.1 downstream_gene_variant ; 4121.0bp to feature; MODIFIER silent_mutation Average:86.572; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0613439992 T -> C LOC_Os06g23030-LOC_Os06g23040 intergenic_region ; MODIFIER silent_mutation Average:86.572; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0613439992 T -> DEL N N silent_mutation Average:86.572; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0613439992 T C -0.01 -0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613439992 NA 6.45E-08 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 1.11E-37 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 3.26E-48 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 1.89E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 5.84E-57 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 2.92E-39 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 1.03E-28 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 5.44E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 6.85E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 1.23E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 4.67E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 4.79E-42 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 2.65E-51 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 7.43E-62 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 3.41E-06 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 1.37E-07 6.03E-09 mr1080_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 6.04E-07 4.27E-09 mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 3.58E-07 6.97E-09 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 3.06E-08 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 3.53E-07 8.98E-09 mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613439992 NA 4.57E-08 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251