\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613434230:

Variant ID: vg0613434230 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13434230
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.24, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ACAATGTAGCAGATGAACTCATCTTTTATTTTCCATGATCTGCAGTGTTGTAGAAAGCTGTCAACTTCATTGTCGTTTACCTTTTTATTTTTATAAATCT[G/A]
GAGTTTTATACAGACGATCCTATGGGCAAGAAGTACTCCTTCGATGCGTGGACATAATCGATGCATATCATGTTTTACAGGAGGTGCATCATGGAGTTTG

Reverse complement sequence

CAAACTCCATGATGCACCTCCTGTAAAACATGATATGCATCGATTATGTCCACGCATCGAAGGAGTACTTCTTGCCCATAGGATCGTCTGTATAAAACTC[C/T]
AGATTTATAAAAATAAAAAGGTAAACGACAATGAAGTTGACAGCTTTCTACAACACTGCAGATCATGGAAAATAAAAGATGAGTTCATCTGCTACATTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.40% 0.36% 0.15% NA
All Indica  2759 95.30% 4.30% 0.18% 0.18% NA
All Japonica  1512 3.90% 95.20% 0.79% 0.07% NA
Aus  269 55.80% 44.20% 0.00% 0.00% NA
Indica I  595 93.80% 6.10% 0.00% 0.17% NA
Indica II  465 95.30% 4.10% 0.43% 0.22% NA
Indica III  913 98.90% 0.70% 0.22% 0.22% NA
Indica Intermediate  786 92.40% 7.40% 0.13% 0.13% NA
Temperate Japonica  767 5.60% 93.10% 1.30% 0.00% NA
Tropical Japonica  504 2.00% 97.80% 0.00% 0.20% NA
Japonica Intermediate  241 2.50% 96.70% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613434230 G -> A LOC_Os06g23010.1 downstream_gene_variant ; 2614.0bp to feature; MODIFIER silent_mutation Average:42.448; most accessible tissue: Callus, score: 73.809 N N N N
vg0613434230 G -> A LOC_Os06g23020.1 downstream_gene_variant ; 601.0bp to feature; MODIFIER silent_mutation Average:42.448; most accessible tissue: Callus, score: 73.809 N N N N
vg0613434230 G -> A LOC_Os06g23030.1 downstream_gene_variant ; 4918.0bp to feature; MODIFIER silent_mutation Average:42.448; most accessible tissue: Callus, score: 73.809 N N N N
vg0613434230 G -> A LOC_Os06g23010-LOC_Os06g23020 intergenic_region ; MODIFIER silent_mutation Average:42.448; most accessible tissue: Callus, score: 73.809 N N N N
vg0613434230 G -> DEL N N silent_mutation Average:42.448; most accessible tissue: Callus, score: 73.809 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613434230 NA 8.79E-12 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 1.08E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 5.09E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 2.37E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 2.63E-07 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 1.56E-25 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 3.05E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 3.05E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 1.31E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 1.25E-09 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 7.23E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 5.86E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 5.98E-06 mr1993 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 1.34E-16 mr1033_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 3.24E-06 NA mr1546_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 6.51E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613434230 NA 1.80E-09 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251