| Variant ID: vg0613383622 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13383622 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTATAATTGACTAGAGAATTTTTAAAAGTTTCAAATCATGCATGTGGCATTTACATATGTTAATTAGAGTTTTTCACAATTTAATTTACGTTCATTCATA[T/C]
GCTAATTATATATGACTATTCGAATTTTTAAAATTTTTAAATCATGCATGTGGCATTTACATATGTTAATTAGAGTTTTTAACAATTAATTTAATATAAT
ATTATATTAAATTAATTGTTAAAAACTCTAATTAACATATGTAAATGCCACATGCATGATTTAAAAATTTTAAAAATTCGAATAGTCATATATAATTAGC[A/G]
TATGAATGAACGTAAATTAAATTGTGAAAAACTCTAATTAACATATGTAAATGCCACATGCATGATTTGAAACTTTTAAAAATTCTCTAGTCAATTATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 31.80% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 96.50% | 3.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 18.70% | 81.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613383622 | T -> C | LOC_Os06g22925.1 | upstream_gene_variant ; 3891.0bp to feature; MODIFIER | silent_mutation | Average:24.553; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0613383622 | T -> C | LOC_Os06g22919.2 | upstream_gene_variant ; 3.0bp to feature; MODIFIER | silent_mutation | Average:24.553; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0613383622 | T -> C | LOC_Os06g22919.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.553; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0613383622 | T -> C | LOC_Os06g22919.3 | intron_variant ; MODIFIER | silent_mutation | Average:24.553; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0613383622 | T -> C | LOC_Os06g22919.4 | intron_variant ; MODIFIER | silent_mutation | Average:24.553; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613383622 | 1.73E-09 | NA | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | 6.96E-09 | 1.65E-14 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | 3.78E-06 | 1.16E-38 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | 3.39E-06 | 6.26E-09 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | 2.83E-07 | 2.83E-07 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | NA | 6.85E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | 2.49E-13 | NA | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | 1.81E-06 | 2.21E-14 | mr1033_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | 1.50E-10 | 2.66E-19 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | NA | 1.73E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | 4.94E-08 | 1.28E-09 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613383622 | NA | 1.11E-08 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |