Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613380876:

Variant ID: vg0613380876 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13380876
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCCCTATAATACCACGGCTAAGGCGTTTGTTCAGGAACAAGGGGAATGCTAGAATGATGCGATGGCACGCTGAAGAGCGTCAACAGGACGGGATGCT[A/G]
AGACATCCCGCCGATGGTTCGCAGTGGCGAAACATCGACAGAAAATTTAAAGAAAATTTGGAAAGGACGCACGAAACATACGGTTTGGTTTGAGTACGGA

Reverse complement sequence

TCCGTACTCAAACCAAACCGTATGTTTCGTGCGTCCTTTCCAAATTTTCTTTAAATTTTCTGTCGATGTTTCGCCACTGCGAACCATCGGCGGGATGTCT[T/C]
AGCATCCCGTCCTGTTGACGCTCTTCAGCGTGCCATCGCATCATTCTAGCATTCCCCTTGTTCCTGAACAAACGCCTTAGCCGTGGTATTATAGGGAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 34.20% 4.91% 0.55% NA
All Indica  2759 89.00% 4.70% 5.47% 0.87% NA
All Japonica  1512 8.50% 90.40% 1.12% 0.00% NA
Aus  269 47.60% 29.70% 22.30% 0.37% NA
Indica I  595 87.60% 4.20% 6.39% 1.85% NA
Indica II  465 92.00% 4.50% 3.01% 0.43% NA
Indica III  913 92.70% 2.20% 4.60% 0.55% NA
Indica Intermediate  786 84.00% 8.00% 7.25% 0.76% NA
Temperate Japonica  767 3.10% 96.50% 0.39% 0.00% NA
Tropical Japonica  504 17.30% 80.60% 2.18% 0.00% NA
Japonica Intermediate  241 7.10% 91.70% 1.24% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 51.10% 44.40% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613380876 A -> G LOC_Os06g22925.1 upstream_gene_variant ; 1145.0bp to feature; MODIFIER silent_mutation Average:44.491; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0613380876 A -> G LOC_Os06g22919.2 upstream_gene_variant ; 2749.0bp to feature; MODIFIER silent_mutation Average:44.491; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0613380876 A -> G LOC_Os06g22919.1 intron_variant ; MODIFIER silent_mutation Average:44.491; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0613380876 A -> G LOC_Os06g22919.3 intron_variant ; MODIFIER silent_mutation Average:44.491; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0613380876 A -> G LOC_Os06g22919.4 intron_variant ; MODIFIER silent_mutation Average:44.491; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0613380876 A -> DEL N N silent_mutation Average:44.491; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0613380876 A G 0.01 0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613380876 8.72E-11 NA mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 4.15E-06 2.76E-09 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 3.30E-10 5.20E-14 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 8.10E-07 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 5.70E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 6.30E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 3.29E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 1.20E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 2.51E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 4.98E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 7.21E-08 1.22E-39 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 2.12E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 7.00E-07 2.18E-09 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 2.86E-06 2.86E-07 mr1227 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 3.51E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 4.05E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 8.81E-07 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 8.57E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 7.96E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 2.44E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 7.92E-12 3.79E-19 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 1.75E-07 NA mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613380876 NA 1.70E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251