\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613374759:

Variant ID: vg0613374759 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13374759
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGATTAAGCATGTCCATGTAAAATACATTGTTATACAAATAAACTCGACCAATGTGCTATTGTATTATTGAAGGTCACATTAGTATATTTAATTAGTTT[T/C]
TAAGAAATATCAAAGCCTAGAAGTTATATTGGATAATTTTTGGATAATCTAAAGGAAAGCAAATTCATTTGGGAACTAATGAATAAATAAATAAATATTC

Reverse complement sequence

GAATATTTATTTATTTATTCATTAGTTCCCAAATGAATTTGCTTTCCTTTAGATTATCCAAAAATTATCCAATATAACTTCTAGGCTTTGATATTTCTTA[A/G]
AAACTAATTAAATATACTAATGTGACCTTCAATAATACAATAGCACATTGGTCGAGTTTATTTGTATAACAATGTATTTTACATGGACATGCTTAATCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 31.90% 0.57% 0.00% NA
All Indica  2759 95.50% 3.70% 0.76% 0.00% NA
All Japonica  1512 9.30% 90.50% 0.26% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.30% 2.20% 1.51% 0.00% NA
Indica II  465 95.50% 4.10% 0.43% 0.00% NA
Indica III  913 95.90% 3.60% 0.44% 0.00% NA
Indica Intermediate  786 94.50% 4.70% 0.76% 0.00% NA
Temperate Japonica  767 3.50% 96.20% 0.26% 0.00% NA
Tropical Japonica  504 18.70% 81.20% 0.20% 0.00% NA
Japonica Intermediate  241 7.90% 91.70% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613374759 T -> C LOC_Os06g22919.1 upstream_gene_variant ; 744.0bp to feature; MODIFIER silent_mutation Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0613374759 T -> C LOC_Os06g22919.3 upstream_gene_variant ; 744.0bp to feature; MODIFIER silent_mutation Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0613374759 T -> C LOC_Os06g22919.4 upstream_gene_variant ; 744.0bp to feature; MODIFIER silent_mutation Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0613374759 T -> C LOC_Os06g22925.1 downstream_gene_variant ; 4636.0bp to feature; MODIFIER silent_mutation Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0613374759 T -> C LOC_Os06g22900.1 intron_variant ; MODIFIER silent_mutation Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613374759 2.75E-13 7.16E-78 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 1.61E-07 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 2.74E-11 3.17E-16 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 1.38E-06 6.76E-10 mr1082 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 3.43E-07 5.57E-09 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 8.06E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 1.46E-10 8.53E-45 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 8.78E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 8.60E-08 1.32E-10 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 8.86E-07 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 6.72E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 3.43E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 6.93E-09 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 4.81E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 6.13E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 4.05E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 3.52E-08 3.52E-08 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 2.09E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 3.07E-10 2.04E-99 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 1.67E-13 1.35E-21 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 NA 3.75E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759 4.78E-09 1.09E-10 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251