Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613374759:

Variant ID: vg0613374759 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13374759
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGATTAAGCATGTCCATGTAAAATACATTGTTATACAAATAAACTCGACCAATGTGCTATTGTATTATTGAAGGTCACATTAGTATATTTAATTAGTTT[T/C]
TAAGAAATATCAAAGCCTAGAAGTTATATTGGATAATTTTTGGATAATCTAAAGGAAAGCAAATTCATTTGGGAACTAATGAATAAATAAATAAATATTC

Reverse complement sequence

GAATATTTATTTATTTATTCATTAGTTCCCAAATGAATTTGCTTTCCTTTAGATTATCCAAAAATTATCCAATATAACTTCTAGGCTTTGATATTTCTTA[A/G]
AAACTAATTAAATATACTAATGTGACCTTCAATAATACAATAGCACATTGGTCGAGTTTATTTGTATAACAATGTATTTTACATGGACATGCTTAATCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.60%	31.90%	0.57%	0.00%	NA
All Indica	2759	95.50%	3.70%	0.76%	0.00%	NA
All Japonica	1512	9.30%	90.50%	0.26%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	96.30%	2.20%	1.51%	0.00%	NA
Indica II	465	95.50%	4.10%	0.43%	0.00%	NA
Indica III	913	95.90%	3.60%	0.44%	0.00%	NA
Indica Intermediate	786	94.50%	4.70%	0.76%	0.00%	NA
Temperate Japonica	767	3.50%	96.20%	0.26%	0.00%	NA
Tropical Japonica	504	18.70%	81.20%	0.20%	0.00%	NA
Japonica Intermediate	241	7.90%	91.70%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613374759	T -> C	LOC_Os06g22919.1	upstream_gene_variant ; 744.0bp to feature; MODIFIER	silent_mutation	Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N
vg0613374759	T -> C	LOC_Os06g22919.3	upstream_gene_variant ; 744.0bp to feature; MODIFIER	silent_mutation	Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N
vg0613374759	T -> C	LOC_Os06g22919.4	upstream_gene_variant ; 744.0bp to feature; MODIFIER	silent_mutation	Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N
vg0613374759	T -> C	LOC_Os06g22925.1	downstream_gene_variant ; 4636.0bp to feature; MODIFIER	silent_mutation	Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N
vg0613374759	T -> C	LOC_Os06g22900.1	intron_variant ; MODIFIER	silent_mutation	Average:61.571; most accessible tissue: Minghui63 panicle, score: 88.893	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613374759	2.75E-13	7.16E-78	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	1.61E-07	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	2.74E-11	3.17E-16	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	1.38E-06	6.76E-10	mr1082	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	3.43E-07	5.57E-09	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	8.06E-07	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	1.46E-10	8.53E-45	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	8.78E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	8.60E-08	1.32E-10	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	8.86E-07	mr1204	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	6.72E-08	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	3.43E-09	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	6.93E-09	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	4.81E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	6.13E-06	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	4.05E-07	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	3.52E-08	3.52E-08	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	2.09E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	3.07E-10	2.04E-99	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	1.67E-13	1.35E-21	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	NA	3.75E-19	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374759	4.78E-09	1.09E-10	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251