\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613373063:

Variant ID: vg0613373063 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13373063
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTTGATTAATCCATTTTGGTCACTTTTGGGAATTTTCTGTTTTCCTTGGAAAAAAAGACAAAAAATCGCCCCCTACAGCCTCCCACCAAAATAGTGAA[T/C]
AATGGGATACAGTTACACTAGGTGGTGGGGGAATTTATACTGTGCAACAAATATCTGTAACGGCCCTAAAACAATCAACCGTGACGAGCGTACAAGTAAT

Reverse complement sequence

ATTACTTGTACGCTCGTCACGGTTGATTGTTTTAGGGCCGTTACAGATATTTGTTGCACAGTATAAATTCCCCCACCACCTAGTGTAACTGTATCCCATT[A/G]
TTCACTATTTTGGTGGGAGGCTGTAGGGGGCGATTTTTTGTCTTTTTTTCCAAGGAAAACAGAAAATTCCCAAAAGTGACCAAAATGGATTAATCAAGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.50% 0.30% 17.39% 41.77% NA
All Indica  2759 17.50% 0.50% 20.26% 61.76% NA
All Japonica  1512 90.50% 0.00% 5.42% 4.10% NA
Aus  269 6.70% 0.40% 43.49% 49.44% NA
Indica I  595 14.60% 0.30% 20.00% 65.04% NA
Indica II  465 10.30% 0.20% 12.69% 76.77% NA
Indica III  913 23.30% 0.80% 24.64% 51.26% NA
Indica Intermediate  786 17.20% 0.40% 19.85% 62.60% NA
Temperate Japonica  767 96.60% 0.00% 0.52% 2.87% NA
Tropical Japonica  504 80.60% 0.00% 13.29% 6.15% NA
Japonica Intermediate  241 91.70% 0.00% 4.56% 3.73% NA
VI/Aromatic  96 1.00% 0.00% 55.21% 43.75% NA
Intermediate  90 50.00% 1.10% 12.22% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613373063 T -> C LOC_Os06g22890.1 upstream_gene_variant ; 3410.0bp to feature; MODIFIER silent_mutation Average:15.453; most accessible tissue: Callus, score: 35.149 N N N N
vg0613373063 T -> C LOC_Os06g22919.1 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:15.453; most accessible tissue: Callus, score: 35.149 N N N N
vg0613373063 T -> C LOC_Os06g22919.3 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:15.453; most accessible tissue: Callus, score: 35.149 N N N N
vg0613373063 T -> C LOC_Os06g22919.4 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:15.453; most accessible tissue: Callus, score: 35.149 N N N N
vg0613373063 T -> C LOC_Os06g22900.1 intron_variant ; MODIFIER silent_mutation Average:15.453; most accessible tissue: Callus, score: 35.149 N N N N
vg0613373063 T -> DEL N N silent_mutation Average:15.453; most accessible tissue: Callus, score: 35.149 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613373063 2.74E-11 3.17E-16 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063 NA 1.81E-06 mr1064 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063 8.60E-08 1.32E-10 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063 NA 5.79E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063 NA 4.58E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063 3.52E-08 3.52E-08 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063 1.67E-13 1.35E-21 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063 4.78E-09 1.09E-10 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251