Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613373063:

Variant ID: vg0613373063 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13373063
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTTGATTAATCCATTTTGGTCACTTTTGGGAATTTTCTGTTTTCCTTGGAAAAAAAGACAAAAAATCGCCCCCTACAGCCTCCCACCAAAATAGTGAA[T/C]
AATGGGATACAGTTACACTAGGTGGTGGGGGAATTTATACTGTGCAACAAATATCTGTAACGGCCCTAAAACAATCAACCGTGACGAGCGTACAAGTAAT

Reverse complement sequence

ATTACTTGTACGCTCGTCACGGTTGATTGTTTTAGGGCCGTTACAGATATTTGTTGCACAGTATAAATTCCCCCACCACCTAGTGTAACTGTATCCCATT[A/G]
TTCACTATTTTGGTGGGAGGCTGTAGGGGGCGATTTTTTGTCTTTTTTTCCAAGGAAAACAGAAAATTCCCAAAAGTGACCAAAATGGATTAATCAAGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.50%	0.30%	17.39%	41.77%	NA
All Indica	2759	17.50%	0.50%	20.26%	61.76%	NA
All Japonica	1512	90.50%	0.00%	5.42%	4.10%	NA
Aus	269	6.70%	0.40%	43.49%	49.44%	NA
Indica I	595	14.60%	0.30%	20.00%	65.04%	NA
Indica II	465	10.30%	0.20%	12.69%	76.77%	NA
Indica III	913	23.30%	0.80%	24.64%	51.26%	NA
Indica Intermediate	786	17.20%	0.40%	19.85%	62.60%	NA
Temperate Japonica	767	96.60%	0.00%	0.52%	2.87%	NA
Tropical Japonica	504	80.60%	0.00%	13.29%	6.15%	NA
Japonica Intermediate	241	91.70%	0.00%	4.56%	3.73%	NA
VI/Aromatic	96	1.00%	0.00%	55.21%	43.75%	NA
Intermediate	90	50.00%	1.10%	12.22%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613373063	T -> C	LOC_Os06g22890.1	upstream_gene_variant ; 3410.0bp to feature; MODIFIER	silent_mutation	Average:15.453; most accessible tissue: Callus, score: 35.149	N	N	N	N
vg0613373063	T -> C	LOC_Os06g22919.1	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:15.453; most accessible tissue: Callus, score: 35.149	N	N	N	N
vg0613373063	T -> C	LOC_Os06g22919.3	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:15.453; most accessible tissue: Callus, score: 35.149	N	N	N	N
vg0613373063	T -> C	LOC_Os06g22919.4	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:15.453; most accessible tissue: Callus, score: 35.149	N	N	N	N
vg0613373063	T -> C	LOC_Os06g22900.1	intron_variant ; MODIFIER	silent_mutation	Average:15.453; most accessible tissue: Callus, score: 35.149	N	N	N	N
vg0613373063	T -> DEL	N	N	silent_mutation	Average:15.453; most accessible tissue: Callus, score: 35.149	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613373063	2.74E-11	3.17E-16	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063	NA	1.81E-06	mr1064	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063	8.60E-08	1.32E-10	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063	NA	5.79E-08	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063	NA	4.58E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063	3.52E-08	3.52E-08	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063	1.67E-13	1.35E-21	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613373063	4.78E-09	1.09E-10	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251